1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
4 years ago
5

The therapeutic effect of insulin in treating type 1 diabetes mellitus is based on which physiologic action

Biology
1 answer:
Katarina [22]4 years ago
4 0
The therapeutic effect of insulin in treating type 1 diabetes mellitus is based on which physiologic action

You might be interested in
Why is it important that the location of fossils found in the ground is recorded?
Eddi Din [679]

Answer:

The fossil record helps paleontologists, archaeologists, and geologists place important events and species in the appropriate geologic era.

Explanation:

It is based on the Law of Superposition which states that in undisturbed rock sequences the bottom layers are older than the top layers.

3 0
3 years ago
Read 2 more answers
Independent and Dependent Variable Practice
Talja [164]

Answer:

1) IV: The quantity of salt added

DV: The resultant density of the salinated water

Hypothesis: The egg will float when the  mass of the volume of the salinated solution displaced by the egg is equal to or larger than the mass of the egg

2) IV: The extension of the rubber band above original length in centimetres

DV: The distance flown by the rubber band

Hypothesis: The potential energy stored in the rubber band by pulling will be transformed into kinetic energy and the larger the extension, the larger the stored potential energy, and the larger the resultant kinetic energy, the higher the velocity and the further the distance flown

3) IV: The wing span of a paper airplane

DV: The distance flown by the plane

Hypothesis; The glide of the airplane is a factor of the wings span increased wingspan increased glide and increased travel distance

4) IV: Presence of more light

DV: Height to which plant grows

Hypothesis: Photosynthesis, which is the conversion of carbon dioxide and water into glucose and oxygen in the presence of Sunlight is essential for plant growth and the more the presence on light is increases the higher plant will tend to grow

5) IV: Amount of vinegar in the canister

DV: The height a rocket will launch

Hypothesis: With a given amount of baking soda, in the canister a little amount of vinegar causes a delayed launch but an increased build up of carbon dioxide resulting in higher height reached than when more vinegar is used in which case the lift off will be more rapid but the power will be lesser and the height reached reduced

6: IV: Surface area of the coin

DV: The number of drops held

Hypothesis: Due to surface tension and cohesion which are properties that increase with surface area and as such a coin with a larger surface area holds more water drops

7. IV: Number of hours of study

DV: Science score

Hypothesis: A student science scores is directly related to the amount of science topics thought the student is able to respond to in a test and it is directly proportional to the amount of study the student has done  related to the science topics

Explanation:

5 0
3 years ago
Explain what a geographic information system (GIS) is, and describe how a GIS is enabling scientists
yulyashka [42]

Answer:

Explanation:

Geographic Information Systems (GIS) store, analyze and visualize data for geographic positions on Earth’s surface. GIS is a computer-based tool that examines spatial relationships, patterns and trends. By connecting geography with data, GIS better understands data using a geographic context.

5 0
3 years ago
The general term that describes the sediment that the river is carrying ?
Vera_Pavlovna [14]
Silt or weathered rock
5 0
3 years ago
What element is in group 18 periodic 3
marishachu [46]

Answer:

ARGON

hope this helps

the element that is in the group 18 periodic 3 is argon

4 0
3 years ago
Read 2 more answers
Other questions:
  • Wind power generates ___.
    13·2 answers
  • which of the following is the heaviest and fastest of all the small wildcats is the _______. a. jaguar b. tiger c. caracal d. bo
    14·2 answers
  • To service the energy needs of the sperm cells, the cell has______?
    8·1 answer
  • In DNA fingerprinting explain how DNA moves through the gel
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Briefly explain what happens to kenkey and fish in the mouth,stomach and the small intestine​
    13·1 answer
  • 1 point
    9·1 answer
  • In certain fish, blue scales (B) and red scales (R) are codominant. Cross a blue
    8·1 answer
  • A human cell with 46 chromosomes undergoes meiosis. What will be the product at the end of meiosis?
    13·1 answer
  • Which structure of eye like as a magnifying glass?<br><br>A) Lens B) Retina C) Pupil D) Cornea​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!