1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eimsori [14]
3 years ago
10

Which is not a negative environmental effect of using high-pressure water hoses on rocky coastlines to clean spilled oil?

Biology
1 answer:
Lubov Fominskaja [6]3 years ago
6 0

The cost of energy to heat water to make steam is not a negative environmental effect of using high pressure water hoses on rocky coastlines to clean the spilled oil. Spilled oil cause environmental pollution to the coastlines and endangers the species the lives of the species living in these coastlines.

You might be interested in
How does society shape a persons identity?
qwelly [4]
Social institutions such as media,education, the government, family and religion all have a significance impact on a person’s identity.
5 0
3 years ago
Which of the following CORRECTLY pairs the type of ribonucleic acid (RNA) with its function during protein synthesis?
ch4aika [34]
You should add a picture
4 0
3 years ago
Which of the following accurately describes HIV?
scoray [572]
The answer is D, because HIV is not AIDS, but can lead to it. HIV is passed through bodily fluids, not one-on-one contact. HIV targets Helper T cells, and it can be up to years for a significant amount of Helper T cell count is lost, becoming AIDS, a life threatening disease. 
6 0
3 years ago
Read 2 more answers
For a person who is heterozygous Aa, the phenotype is:
babunello [35]
Answer: c. The same as the phenotype of a homozygous AA person.

Explanation: The capital A represents the dominant property of the person’s genes. The lowercase a is recessive. This means that the dominant quality will always trump the recessive quality. That is why they are the same as the homozygous AA person.
8 0
3 years ago
Which statement best describes the relationship between proteins and nucleic acids?
swat32
Three-letter sets, or codons, of nucleic acids "code" for individual amino acids. Amino acids form proteins. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • Sperm cells require approximately _______ to mature before they are ready for ejaculation.
    7·1 answer
  • Show two methods of factoring ax - bx - ay + by
    5·1 answer
  • This is an invertebrate animal with radial symmetry. Most reproduce sexually with external fertilization. This is the simplest i
    11·2 answers
  • What kinds of substances besides water can be involved in hydrogen bonding?​
    15·2 answers
  • If you could expose plants to just one wavelength of light at a time, would a wavelength of 300 nm, 450 nm, or 600 nm produce th
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Tallness (T) is dominant to shortness (t) in pea plants. Which of the following represents a genotype of a pea plant that is het
    12·1 answer
  • How similar is your genetic information to that of your parents?
    8·2 answers
  • Which solution is more diluted? Solution 1:
    14·1 answer
  • The term "survival of the fittest' means
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!