1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
15

- Enzymes serve several functions during DNA replication. Namne two of these functions.

Biology
1 answer:
Advocard [28]3 years ago
7 0

Answer:

Topoisomerase and Primase

Explanation:

Topoisomerase — Relaxes the super-coiled DNA

Primase — Provides the starting point for DNA polymerase to begin synthesis of the new strand

You might be interested in
During _______ reproduction, cells can produce genetically different offspring, whereas during _______ reproduction, cells produ
horsena [70]
Sexual, asexual hope this is what u are looking for
3 0
3 years ago
Read 2 more answers
ASAP test tomorrow <br><br><br>how is " produces " represented in a chemical reaction ?​
sergeinik [125]

In a chemical reaction, the atoms and molecules that interact with each other are called reactants. In a chemical reaction, the atoms and molecules produced by the reaction are called products. In a chemical reaction, only the atoms present in the reactants can end up in the products.

Hopefully this helps!

8 0
3 years ago
4. Name the dark, linear, thread-like structures that you can see in some of the onion root tip cells. What Biomolecule of hered
mario62 [17]
So dark linen thread structure is chromosome that we see. And and by molecule heritage that we contain.
3 0
2 years ago
Some archaea (single cell organisms) live in extremely salty water such as the Great Salt Lake or the Dead Sea. Most types of ce
kaheart [24]
Halophiles are extremophiles that thrive in environments with very high concentrations of salt. <span>Halophiles prevent this loss of water by increasing the internal osmolarity of the cell by accumulating </span>osmoprotectants<span> or by the selective uptake of potassium ions. Hope this helps.</span>
<span />
8 0
3 years ago
Read 2 more answers
Succession occurs when environmental factors affecting an ecosystem change. True or False
zhannawk [14.2K]

Answer: True

Succession is the phenomena in which changes in the biotic and abiotic factors of the environment leads to change in the ecosystem. A succession is a process in which a biological community is replaced by another biological community until a mature ecosystem is formed this process is influence by environmental factors. Primary succession is the primitive environment where no biotic community previously existed it is followed by secondary and subsequent succession were life forms develop and form an ecosystem. Some of the environmental factors are:

Topographical : These are the change in the region or habitat were succession occurs. Landslides, volcanic eruption, glacier melting etc. are the examples , as these topographical changes can bring reformation of the landscape. The disturbance caused by these topographical changes will allow the disturbance tolerant species to repopulate the habitat.  This can be a transition from primary to secondary succession.

Soil : It is an abiotic factor.The growth of the plants requires suitable soil conditions. The type of soil will affect which species will inhabit the area. The soil moisture and pH greatly affect the number of plant species in an area.

Climate : It can influence the direction of succession. Climatic factors includes rain, wind etc. For example a region lacking proper rainfall the species will be tolerant to dry and drought conditions. The region with heavy rainfall, the species will be more tolerant to moisture. Wind being a climatic factor can cause wind erosion affect the soil quality. Wind can lead to heavy forest fires can therefore, wiped out community.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Plants are green because they contain large amounts of green pigments called chlorophylls. what purpose does chlorophyll serve f
    5·1 answer
  • What process has most likely occurred when new traits appear in a species
    7·1 answer
  • Why does Ice Float on water? How does this affect life in Earth’s aquatic environments?
    13·2 answers
  • 6 points
    13·1 answer
  • A certain plant species has seeds that remain dormant until heat stimulates them to germinate.
    14·1 answer
  • What must a virus have in order to reproduce?
    7·1 answer
  • Which statement describes the weather and climate in a tropical region?
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • According to United States predictions, what will be the total population of the world by 2100?
    7·1 answer
  • What do you call a patch of jasmine
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!