1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ierofanga [76]
3 years ago
14

Can I only have 1 to 2 White Cloud Mountain Minnows or do I have to have them in a School

Biology
1 answer:
Gnom [1K]3 years ago
4 0
1 or 2 is just fine. The bigger the group, the higher success rate for breeding. Good luck!
You might be interested in
Which process causes Earth to lose thermal energy to space?
geniusboy [140]
I believe it would be Heat Radiation
8 0
3 years ago
Read 2 more answers
Explain how Earth’s atmosphere affects solar radiation
3241004551 [841]

Answer:

Explanation: Three atmospheric processes modify the solar radiation passing through our atmosphere destined to the Earth's surface. These processes act on the radiation when it interacts with gases and suspended particles found in the atmosphere.

3 0
3 years ago
Cost is an example of a(n) constraint in designing a product. t or f
Temka [501]
I'm pretty sure that it is true


4 0
3 years ago
The greatest concentration of public land is in ____.
Licemer1 [7]
The greatest concetration of public land is A. texas
3 0
3 years ago
Read 2 more answers
Dr. Suri placed a dog on the scale at the veterinary clinic. Then she recorded a
Ad libitum [116K]

Answer:

a

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • The cell theory teaches that _____.
    5·2 answers
  • How does a runner acquire an oxygen debt ?
    10·1 answer
  • What helps regulate movement of substances through a cell's membrane?
    6·1 answer
  • Please help thank you
    5·1 answer
  • Elements in organic compounds are represented by?
    14·2 answers
  • The atmosphere protect us from ___ and ___
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Looking at a cell under a microscope, you note that it is a prokaryote. How do you know? (1 point)
    13·2 answers
  • 1. How are seasons connected to the annual CO2 cycle?
    13·1 answer
  • Which of the following plants is likely to be a pioneer species
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!