1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ket [755]
3 years ago
7

imagine a cell-surface receptor protein is being newly synthesized. How can it get into the membrane that it will ultimately be

a part of? Make a list showing the general steps required for the protein to go from its inception (DNA stage) to its final job site (membrane
Biology
1 answer:
motikmotik3 years ago
8 0

Answer:

the steps for a new receptor synthesis:

Explanation:

Do not forget the steps vary from an eukarityc cell to prokarityc one.  

IN AN EUKARYOTIC CELL:

1- Transcription: in the nucleus, mRNA is synthesized from the DNA sequence that codifies the protein. Exons are spliced if needed by spliceosomes.  

2- From nucleus into cytoplasm: mRNA goes through nuclear membrane into the cytoplasm were ribosomes, substrates for protein synthesis and other organelles are.

3- Ribosomes recognize a signal in mRNA and start reading the genetic code, three consecutive nucleotides at a time and adjust the correspondent tRNAs (tRNAs carry the aminoacids)  

4- Peptide bonds are formed between consecutives aminoacids, and a polypeptide is build up according to the mRNA sequence.

5- (The mRNA has a signal that is recognized by the rough endoplasmic reticulum) The peptide goes into this reticulum (RER) and then into Golgi apparatus. (more chemical modifications are made if needed). By this moment the protein has an inserted portion in a lipid membrane.

6- The protein is transported in a vessel that finally fusions with cytoplasmic membrane and the receptor is in destiny. Hydrophobic aminoacid sequences are inserted in membrane.

IN A PROKARYTIC CELL:

1- Transcription (no splicing is needed, there are not exons)

2- There are not nucleus and cytoplasm divided (no transport)

3- Ribosomes recognize a signal in mRNA and start reading the genetic code, three consecutive nucleotides at a time and adjust the correspondent tRNAs (tRNAs carry the aminoacids)

4- Peptide bonds are formed between consecutives aminoacids, and a polypeptide is build up according to the mRNA sequence.

5- The mRNA has a signal that is guides the growing protein to cellular membrane. Hydrophobic aminoacid sequences are inserted in membrane.

You might be interested in
If a female did not produce sufficient quantities of fsh and lh how would her ability to have children be affect
nevsk [136]
Follicle stimulating hormone (FSH) and Luteinizing hormone (LH) are Gonadotropins stimulated in the gonads. In females, they are located in the ovaries. They are not needed for life yet important for reproduction. Progesterone which is being secreted in corpus luteum is needed for maintenance of pregnancy thus if a female has a low FSH and LH it will affect the chance of her be pregnant.
7 0
3 years ago
Read 2 more answers
The Milky Way a section of the universe smaller in size than our solar system, true or false
kakasveta [241]

Answer:

The answer is false, because our solar system exists inside the Milky Way.

Explanation:

3 0
3 years ago
Read 2 more answers
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
What happens to glucose during cellular respiration
nekit [7.7K]

Explanation:

During cellular respiration, glucose is broken down and energy is released in the process.

  • Cellular respiration is a metabolic process by which energy is produced.
  • In this process, chemical energy stored in the chains of the glucose atoms are transformed into heat energy.
  • In cellular respiration, glucose combines with oxygen.
  • The product is the formation of carbon dioxide and water with the release of energy.
  • This energy is stored in form of ATP.
  • To be released, one Phosphate is detached to produce ADP.

learn more:

Fermentation brainly.com/question/12792548

#learnwithbrainly

4 0
2 years ago
Characteristics of a Mink
Harrizon [31]
A learned behavior is a behavior towards responding to a stimulus.In this case, the characteristic of a mink which is leaned will be to release a smelly fluid from a scent gland when threatened.In addition,a learned behaviour occurs when an individual acquires changes in their behaviour which is obtained from their daily interaction with the environment.
6 0
2 years ago
Other questions:
  • The native structure of hemoglobin (hb) comprises of two α and two β subunits, each of which carries a heme group. there appear
    8·2 answers
  • HURRYYYYYY PLEASE!!!!!!!!!!!
    14·2 answers
  • The probability of flipping a coin twice and getting heads is_______
    12·2 answers
  • HURRY!!!!
    11·2 answers
  • If a substance has a density of 2.5 g/ml and the volume of the substance is 8 ml what is the mass of the substance
    12·1 answer
  • The movement of a plant's leaves to face the sun as it moves across the sky is an example of
    14·2 answers
  • Which of these organs removes old or damaged blood cells from the blood that flows through it
    9·2 answers
  • Use the drop-down menus to complete the sentences.
    5·2 answers
  • scientists on mars have been investigating the genetic makeup of organisms in this community. use the information provided and y
    11·2 answers
  • How are a black hole and a neutron star similar and different?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!