1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmainna [20.7K]
3 years ago
13

Need help with 9 pls

Biology
1 answer:
EastWind [94]3 years ago
5 0

its a plus b sqaured

You might be interested in
What is shown in the image below?
Temka [501]

Answer:

There is no image shown

6 0
3 years ago
Which type of rock is formed from cooling molten rock?
Sholpan [36]
Igneous. Igneous forms when lava cools off. :)
7 0
3 years ago
Read 2 more answers
80 POINTS GIVING BRAINLIEST QUESTION ATTACHED BELOW
Cloud [144]

Answer:

How will the changes to the geosphere affect the atmosphere hydrosphere and biosphere?

Hydrosphere causes erosion of geosphere through running water and precipitation. … Atmosphere gets water vapor from hydrosphere. Geosphere creates, destroys and keeps various biosphere places safe

Explanation:

8 0
2 years ago
Read 2 more answers
Molecules move from greater to lesser concentration through a transport protein in
PilotLPTM [1.2K]
Facilitated diffusion

<span>The word 'diffusion' means free movement across distance, with or without the presence of a barrier. However, there is a phenomenon known as facilitated diffusion which occurs at the cellular level. The cell does not allow free radicals and other harmful substances to enter and harm the cell organs. This is possible due to the structure of the cell membrane. The structure is such that, it allows only certain things to pass in and out of the cell. One such activity that allows selective movement in and out of the cell is the process of facilitated diffusion.</span>

6 0
3 years ago
What is the name for the amount of energy that a reaction needs to get started?
Elenna [48]
Activation energy ........
7 0
3 years ago
Other questions:
  • describe a procedure humans may have used to produce broccoli, which has small flowers and thick stems?
    7·1 answer
  • 1) A scientist must always try to avoid _____________ in scientific experime
    14·1 answer
  • 1. In the 1800s, French biologist Pierre Flourens and surgeon Paul Broca conducted research that demonstrated a connection betwe
    15·1 answer
  • Explain the similarities and differences between ice ages and volcanic eruptions
    6·1 answer
  • What would happen if your body wasn't in homeostasis
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Imagine that a researcher discovers two new similar species of bats in the same geographic area. Amazingly, one of these species
    5·1 answer
  • Why are bacteria needed in the nitrogen cycle?
    13·1 answer
  • Two solutions will be prepared with the mixture of distilled water and stock solution of KMnO4 (10 mM). Give the correct volumes
    14·1 answer
  • ________ reinforcers have innate reinforcing qualities.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!