1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
15

Centrosomes are sites where protein dimers assemble into what

Biology
1 answer:
Mkey [24]3 years ago
3 0

Answer;

-Microtubules

Explanation;

-Centrosomes are structures found inside of cells. They are made from two centrioles. Centrioles are microtubule rings. The main purpose of a centrosome is to organize microtubules and provide structure for the cell, as well as work to pull chromatids apart during cell division.

-Plant and animal cell centrosomes play similar roles in cell division, and both include collections of microtubules, but the plant cell centrosome is simpler and does not have centrioles.

You might be interested in
The environmental benefits of composting include all of following EXCEPT____________.
andriy [413]

Answer:

B. generation of rich organic fertilizer.

Explanation:

Compost and fertilizers are different. There is a simple way to distinguish between compost and fertilizers.  Compost feeds the soil, and fertilizer feeds the plants. Fertilizer adds to the soil for nutrient supplying purpose to the plants. But compost helps to increase the microbial activities of the soil, which improves the health of the soil.

6 0
3 years ago
Tissue found in leaf stalks below the epidermis is________.
NISA [10]
<h2 /><h2><em><u>Collenchyma</u></em><em><u>.</u></em></h2>

<em><u>Explaination</u></em>

<em><u>Collenchyma is the tissue found below the epidermis of a leaf stalk. These are simple permanent tissue, perform photosynthesis when chloroplast is present</u></em><em><u>.</u></em>

5 0
3 years ago
Read 2 more answers
Where did the carbon in living hings come
agasfer [191]
<span>It was made in stars that lived before the solar system formed.

Hope this helps!

-Payshence xoxo</span>
3 0
3 years ago
Why is temperature a quantitative measurement?
irakobra [83]
Temperature is a quantitative measurement because it can be "measured". Quantitative data is where you record data that is measurable. Qualitative data is research collected from observations.
6 0
3 years ago
Read 2 more answers
What is the correct sequence of molecules involved in protein synthesis from beginning to end?
xz_007 [3.2K]

Answer:

DNA → mRNA → tRNA → Protein

DNA → mRNA → tRNA → Protein

Explanation:

This is because during protein synthesis, DNA is use to make RNA in the process called transcription. The DNA double strand is unwind by an enzyme called RNA polymerase to produce mRNA in the nucleus. The trans is produced in the nucleolus by RNA polymerase 1 and the site then binds aminoacyl tRNAs which is assembled in the RIBOSOMES. The tRNA are then translated into protein.

8 0
2 years ago
Other questions:
  • A science student makes the following statement
    6·2 answers
  • A population of birds has three beak variations, a large beak (suitable for eating seeds), long beaks (suitable for catching sma
    7·1 answer
  • A woman becomes pregnant. Which of the following is the best thing she could do for her baby?
    6·2 answers
  • Explain how diabetes can affect two other human body systems
    12·1 answer
  • Antibiotics can be used to treat
    11·2 answers
  • What type of energy is present inside the nucleus of an atom?
    14·2 answers
  • Which statement correctly describes glucose (C6H1202)?
    12·2 answers
  • In your own words, what is the definition for substrate with enzyme.
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which two products are bromelain likely to produce when breaking down proteins
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!