1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nirvana33 [79]
3 years ago
15

Which describes the part of Africa below the Equator

Biology
1 answer:
Gnom [1K]3 years ago
4 0

Answer:

South Africa

Explanation:

You might be interested in
PLEASE HELP ME!!! I DONT KNOW HOW!!
Natalija [7]
The difference between analog and digital signals is that an analog signal is a continuous electrical message while digital is a series of values that represent information. Analog is conveyed by electrical current variations.




6 0
3 years ago
Read 2 more answers
To grow, plant cells must produce new components of the cell membrane, including phospholipids and membrane proteins. Components
Makovka662 [10]

Answer:

endoplasmic reticulum

Explanation:

ER is full with proteins than help to synthesize phospholipids in plant cells

4 0
3 years ago
The first eukaryotes evolved 2.5bya.<br> A.True<br> B. False
faltersainse [42]
It would be A. True. I hope this helped you. Have a good afternoon
5 0
3 years ago
In the space on the left below, sketch what you would think that glucose 6 phosphate looks like. In the right, modify your sketc
Oxana [17]

Answer:

I think it is white and is looks like powder and is has a strong smell.

Explanation:

If I'm right please give brainliest. sorry if wrong.

7 0
3 years ago
Select the best answer for the question.
Anna71 [15]

Answer:D

Explanation:

Because the plant would get alot of light

The plant needs carbon dioxide to live and moderate temp because its not to hot and not to cold

7 0
3 years ago
Other questions:
  • Rag the pink labels to the pink targets, indicating the relative concentration of glucose inside and outside the cell. drag the
    10·1 answer
  • Some individuals are unable to digest the lactose found in the milk of Cows. The digestive systems of these individuals most lik
    14·2 answers
  • "both a kin selection theory and an alternative "fertile females" theory have been used to explain the transmission of genes tha
    8·1 answer
  • "in june 2011, first lady michelle obama and the usda unveiled the federal government's new food icon, myplate, to help consumer
    7·1 answer
  • Population
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Wild hogs introduced to Texas from Europe became feral after the
    8·1 answer
  • Please help it’s urgent!!!!
    10·1 answer
  • The first word of the scientific name is capitalized, functions as a(n)
    10·1 answer
  • Why is ATP production Constant?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!