1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
4 years ago
12

Which statement best describes how an Alaskan spruce reacts to fire A.resistance B.resilient C.tolerant D.pioneer

Biology
2 answers:
agasfer [191]4 years ago
7 0
The correct option is RESILIENT.
The Alaskan forest usually undergo fire incident every year in order to enhance nutrient cycling of the ecosystem. Alaskan spruce is one of the plant find in the Alaskan forests and it is a very resilient plant, in that, when it is destroy by fire incident, it quickly grow back.
konstantin123 [22]4 years ago
3 0

Answer:

The answer is option B.

Explanation:

The Alaskan woodland more often than not experience fire occurrence consistently with the end goal to improve supplement cycling of the environment. Alaskan spruce is one of the plant find in the Alaskan woodlands and it is an exceptionally versatile plant, in that, when it is demolish by flame episode, it rapidly develop back.

You might be interested in
Function of mitochondria<br>In points (at least 7 points) ​
Fofino [41]

Answer:

Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

7 0
3 years ago
Which of these structures transports sugars from the leaves to the roots? A-xylem b-tracheids C- trichomes D-phloem
polet [3.4K]
It isn't a because the xylem transports water and nutrients. Tracheids transport water and salt minerals. It would not be trichomes because they are little hairs on the plants. It would D because the phloem transports sugars and wastes.
8 0
3 years ago
Read 2 more answers
Increasing number of passes beyond 4 does not increase sensitivity of detection of pancreatic malignancy by endoscopic ultrasoun
Kamila [148]

Increasing number of passes beyond 4 does not increase sensitivity of detection of pancreatic malignancy by endoscopic ultrasound–guided fine-needle aspiration.

This is an article written by contribution of many authors published in Clinical gastroenterology and hepatology that is the official clinical practice journal of the American Gastroenterological Association. In which the authors are aimed to define the yield of EUS-FNA responsible for malignancy of pancreatic mass, and to identify factors which are associated with detection of these malignancies.

<span>After the study they found that only 4 passes of EUS-FNA are sufficient to detect malignant pancreatic masses and if the number of passes increases, it did not increase the sensitivity of detection.</span>

4 0
4 years ago
What therapy cures genetic disorders by inserting normal genes into sales with mutant genes?
Rama09 [41]
Answer: Gene therapy.
8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • Blood flow (liter/min) through the pulmonary circuit equals blood flow through the systemic circuit, but pulmonary resistance is
    8·1 answer
  • What are the two main categories of mutations that occurr in humans
    14·1 answer
  • What variables could influence the width of marine magnetic anomalies on the floor of the ocean?
    7·1 answer
  • Are lipids that serve as chemical messengers.
    6·2 answers
  • There are numerous kinds of shampoo, including vitamin-enriched, fruit-enhanced, color-sensitive, therapeutic, and so on. Shampo
    6·1 answer
  • Can someone please tell me some basic facts about the golgi body? I've done a ton of research and still can't really understand
    15·1 answer
  • When you get excited and your adrenaline starts pumping, your body is experiencing evolution
    14·1 answer
  • (please help me )
    5·1 answer
  • Cichlids, a type of fish, were introduced to a lake around 200 years ago. Over the years, the fish have developed into two disti
    7·1 answer
  • Do sound waves travel faster in high density media
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!