Answer:
Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).
It isn't a because the xylem transports water and nutrients. Tracheids transport water and salt minerals. It would not be trichomes because they are little hairs on the plants. It would D because the phloem transports sugars and wastes.
Increasing number of passes beyond 4 does
not increase sensitivity of detection of pancreatic malignancy by endoscopic
ultrasound–guided fine-needle aspiration.
This
is an article written by contribution of many authors published in Clinical
gastroenterology and hepatology that is the official clinical practice journal
of the American Gastroenterological Association. In which the authors
are aimed to define the yield of EUS-FNA responsible for malignancy of pancreatic
mass, and to identify factors which are associated with detection of these malignancies.
<span>After the study they found
that only 4 passes of EUS-FNA are sufficient to detect malignant pancreatic
masses and if the number of passes increases, it did not increase the
sensitivity of detection.</span>
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
