Together the insulin and glucagon help maintain a state is known as homeostasis in which conditions inside the body remain steady.
<h3>
What is homeostasis?</h3>
Homeostasis refers to the mechanism of the body to maintain a stable internal environment instead of changes taking place in the external environment.
When blood sugar is too high, the pancreas secretes more insulin. When blood sugar levels drop, the pancreas releases glucagon to raise them.
For more information regarding homeostasis, visit:
brainly.com/question/1046675
#SPJ1
Fruits contain acids that make them sweet!
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
chemical reaction is both photosynthetic and cellular respiration
Well think about it during that time it is freezing cold the water cycle comes up from a sea and makes clouds that will be no effect to it but what happens when you put water in a freezer its cold so the result is its gonna hail
