1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pochemuha
3 years ago
11

What is the function of the cytoplasm?

Biology
2 answers:
trasher [3.6K]3 years ago
4 0
Function of Cytoplasm. The jelly-like fluid that fills a cell is called cytoplasm. It is made up of mostly water and salt. Cytoplasm is present within the cell membrane of all cell types and contains all organelles and cell parts. ... It helps to fill out the cell and keeps organelles in their place.
melomori [17]3 years ago
4 0

Answer:

It gives cells it's shape.

Explanation:

It helps to fill out the cell and keeps organelles in their place.

You might be interested in
Homeostasis is the condition the body is in when all substances or variables in the body are at an ideal state. If necessary, fe
sergeinik [125]

Together the insulin and glucagon help maintain a state is known as homeostasis in which conditions inside the body remain steady.

<h3>What is homeostasis?</h3>

Homeostasis refers to the mechanism of the body to maintain a stable internal environment instead of changes taking place in the external environment.

When blood sugar is too high, the pancreas secretes more insulin. When blood sugar levels drop, the pancreas releases glucagon to raise them.

For more information regarding homeostasis, visit:

brainly.com/question/1046675

#SPJ1

8 0
2 years ago
What make frute sweet
agasfer [191]
Fruits contain acids that make them sweet!
6 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Is chemical reaction photosynthesis, celluar respiration or both?​
ankoles [38]

Answer:

chemical reaction is both photosynthetic and cellular respiration

7 0
3 years ago
HELP PLEASE! I'M STUCK!<br> During time of vast glaciations, how is the water cycle affected?
Zolol [24]
Well think about it during that time it is freezing cold the water cycle comes up from a sea and makes clouds that will be no effect to it but what happens when you put water in a freezer its cold so the result is its gonna hail
5 0
3 years ago
Other questions:
  • Which description refers to cumulus clouds?
    5·1 answer
  • Stimulated digestion is to inhibited digestion as the
    9·1 answer
  • An organism’s traits are determined by the specific combination of inherited _____.
    10·1 answer
  • Use the drop-down menus to label the organelles in the picture to the right label A
    10·2 answers
  • Which route of water gain makes up a much larger share of the total in a kangaroo rat as compared to a human?
    9·2 answers
  • What is range of normal tempreture of an organism?
    10·1 answer
  • Mendel studied heredity in _______ plants.
    14·2 answers
  • What is the sign of y. (x/y) ?<br><br>Choose 1 answers<br>A Positive<br>B Negative<br>C<br>Zero​
    7·1 answer
  • The brain signals the body of an animal to move by transmitting electrical impulses through the neurons. An animal is then able
    6·1 answer
  • What type of energy is wind captured by wind turbines?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!