1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
2 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]2 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
Which graphs in the Gizmo show a positive relationship
Iteru [2.4K]
What is this gizmo that you are talking about
8 0
3 years ago
Activity 7.1 what controls the movement of materials into and out of the cell
notka56 [123]
Cell membrane is a semipermable, which means that certain molecules will be able to pass through the membrane. It is contains phospholipids. But for smaller molecules such as CO2 and Water, it can pass through the membrane through simple diffusion. Cell membrane controls the movement of the materials into and out of the cell.
5 0
3 years ago
A physician conducts a survey among 100 patients suffering from migraine headaches to assess the range of headache severity amon
geniusboy [140]
In order to interpret the results obtained from this kind of survey, we simply could not rely on the number alone.
So, the data analysis that he would likely to apply to interpret the results would be : Qualitative and inferential

hope this helps
7 0
3 years ago
When mites or fleas live in a dog's fur, what type of relationship is it?
sleet_krkn [62]
I believe the answer is (B) Parasitic.
6 0
2 years ago
When one species of an ecosystem is endangered, other species that interact with or depend on it are never negatively impacted d
Brums [2.3K]
The statement above is FALSE.
When a particular specie in an ecosystem is endangered, other species that interact with it will be negatively affected and the ecosystem may be throw out of balance. This is because all the components of the ecosystem depend on one another for survival.
6 0
2 years ago
Other questions:
  • Which prokaryotic organism shows up as the earliest fossils?
    7·2 answers
  • Which glial cells support neurons metabolically
    14·1 answer
  • Content to be covered, activity sequence, training media, exercises, and the timing of each activity are considered parts of a:
    14·1 answer
  • Which dating technique could you use to get an estimated age in years from a bone that is known to be less than 40,000 years old
    14·1 answer
  • Why do cats and humans have similar bones
    6·1 answer
  • Identify the type of factor (environmental, pathogen, or genetic) or combination of factors that causes each of the following di
    7·1 answer
  • What the chance of two parent with blood type AB and O ?<br><br> A)25%<br> B)0%<br> C)50%<br> D)75%
    10·1 answer
  • Oops I don’t know how to delete this
    13·1 answer
  • Always return the
    11·1 answer
  • How are the sensory regions of the brain related to synesthesia?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!