1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
Which of the following statements best defines the term operon? a. An operon is a region of RNA that consists of the coding regi
denis-greek [22]

The correct answer is: c. An operon is a region of DNA that codes for a series of functionally related genes under the control of the same promoter.

Operons contain cluster of genes that are transcribed together into mRNA or are not expressed at all. Formed mRNA undergos splicing to create monocistronic mRNAs so that can be translated separately. Operons are more often found in prokaryotic cells but it can appear in eukaryotic cells and in viruses.  

8 0
3 years ago
Describe the structural features of fish that are adapted to life entirely in water
Jlenok [28]

Answer:

Fish have gills that allow them to “breathe” oxygen in the water. Water enters the mouth, passes over the gills, and exits the body through a special opening. Gills absorb oxygen from the water as it passes over them

Explanation:

please mark brainliest

5 0
2 years ago
Photosynthetic pigments, which absorbs the most sunlight and at which wavelength(s) of visible light?
vichka [17]
<span>Photosynthetic pigments, which absorbs the most sunlight is chlorophyll a.
This is the most abundant pigment in plants which absorbs visible light with wavelengths of 430nm( blue) and 662nm( red). It contains a hydrophobic phytol chain (in a lipid membrane) and a tetrapyrrolic ring (outside of the membrane) that absorbs the energy from light. At the centre of the structure is magnesium, Mg that can accept and donate e-.</span>
7 0
3 years ago
Which kingdom represents both multi &amp; unicellular organisms?
garri49 [273]
Protist and fungi both have multi and unicellular organisms
8 0
3 years ago
Which of the following statement is true about the structure of DNA?
Zarrin [17]

Answer:

info?

Explanation:

3 0
3 years ago
Other questions:
  • Cillia are underlying hair-like projections comprised of
    11·1 answer
  • Are viruses living organisms
    13·2 answers
  • Bacteria in your intestines are an example of mutualism if they
    13·1 answer
  • Cardiac muscles are considered smooth muscles. true or false
    7·2 answers
  • if you found rocks that had been buried deep within the earth under high heat and pressure, they would most likelybe what type o
    6·2 answers
  • A scientist is observing various phenomena in the environment. He wants to plot the position of various objects as a function of
    8·2 answers
  • 1. In the kelp forest ecosystem, what type of consumer is the sea
    12·1 answer
  • Which property of water is shown in the model below?
    6·1 answer
  • Help Help Help Help Help Help please .. thank youuuuu :') I will brainliest to whoever answers first and correct! ​
    5·2 answers
  • HELP PLZ NEED THIS RIGHT AWAY 25 PTS
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!