1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
What do you think selectively permeable means?
enot [183]

Answer:

B. The membrane lets certain substances move across it freely, while others must move through a “gate”.

Explanation:

Selective permeability is a property of cellular membranes that only allows certain molecules to enter or exit the cell. This is important for the cell to maintain its internal order irrespective of the changes to the environment. For example, water, ions, glucose and carbon dioxide may need to be imported or exported from the cell depending on its metabolic activity. Similarly, signaling molecules may need to enter the cell and proteins may need to be released into the extracellular matrix. The presence of a selectively permeable membrane allows the cell to exercise control over the quantum, timing and rate of movement of these molecules.

3 0
3 years ago
Read 2 more answers
What rights did the magna carta give to free Englishmen
julia-pushkina [17]
In 1215, after King John of England violated a number of ancient laws and customs by which England had been governed, his subjects forced him to sign the Magna Carta, which enumerates what later came to be thought of as human rights
7 0
3 years ago
Sedimentary rocks are formed when soil, rocks, or the remains of dead organisms undergo layering and compaction over a long peri
Tasya [4]

D.) The original items making the rock.

6 0
3 years ago
Read 2 more answers
Are coins in your pocket a homogeneous mixture or a heterogeneous mixture? Explain.
musickatia [10]
Homogeneous mixture.
8 0
3 years ago
What are the characteristics of scientific explanation
yanalaym [24]
<span>A scientific theory is a well-substantiated explanation of some aspect of the natural world that is acquired through the scientific method and repeatedly tested and confirmed through observation and experimentation.</span>
5 0
3 years ago
Other questions:
  • How does cohesion and adhesion help plants move materials'?
    13·1 answer
  • Imagine for a moment that you are a chromosome. Sometimes your life as a chromosome goes very smoothly. You’re copied, you go th
    9·1 answer
  • State one reason why an individual’s pulse rate increased during exercise.
    10·1 answer
  • IMP is the metabolic intermediate where purine biosynthesis branches for synthesis of
    11·1 answer
  • PLEASE HELP ASAP!!!!
    5·1 answer
  • PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA POINTS*.. <br> IM GIVING 40 POINTS !! DONT SKIP :((.
    6·1 answer
  • Write a list of easy starter pets for kids. (yes this is a real question I have an extracurricular class)
    11·1 answer
  • What is the benefit of using sunscreen when working outside every day?
    12·2 answers
  • Think about how acids and bases would affect the water quality in the two lakes. which set of ph data would you expect to see ba
    5·2 answers
  • What is skeletal system?<br>​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!