1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
2 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]2 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
State what enzymes are made of
creativ13 [48]
Enzymes are large molecules that speed up the chemical reactions inside cells. Each type of enzyme does on specific job. Enzymes are a type of protein, and like all proteins<span>, they are made from long chains of different </span>amino acids<span>.</span>
4 0
3 years ago
Read 2 more answers
How is a ciadogram used?
Montano1993 [528]

Answer:

A cladogram is a diagram used to represent a hypothetical relationship between groups of animals, called a phylogeny. A cladogram is used by a scientist studying phylogenetic systematics to visualize the groups of organisms being compared, how they are related, and their most common ancestors.

3 0
3 years ago
Read 2 more answers
Conservation is the sensible and careful use of the earth's natural resources. Which example does not belong?
ella [17]
C, the act of deforestation is contrary to conservation efforts.
7 0
3 years ago
Read 2 more answers
Hormones are chemical substances that regulate many of the body's functions. true or false
liraira [26]
True. <span>Hormones are chemical substances that regulate many of the body's functions. </span>Hormones are chemical substances<span>, formed in a tissue or organ, that stimulate or inhibit the growth or </span>function of other tissues or organs.  They  <span>work in conjunction with the endocrine, nervous, and immune systems to </span>regulate many body functions.
8 0
3 years ago
What is missing from the food chain? ( look at number 7)
irina [24]

Answer:

decomposer

Explanation:

producer-consumer-decomposer

6 0
3 years ago
Other questions:
  • Which is not a property of water?
    13·1 answer
  • What is the largest fish in the world
    7·1 answer
  • What statements explain how lakes form? Check all that apply
    15·1 answer
  • The _____ hypothalamus signals an animal to start eating, whereas the _____ hypothalamus signals the animal to stop eating.
    7·1 answer
  • The diagram shows the process of meiosis. How many divisions are required to decrease chromosome numbers and produce gametes?
    10·2 answers
  • What is an important difference between viruses and living cells
    10·1 answer
  • Researchers recently discovered an exquisite fossil of a fern (land plant) in sweden. the plant was preserved instantaneously wh
    15·2 answers
  • What is the role of a molecule that controls a repressible operon??
    14·1 answer
  • Which of the following is NOT true of proteins? *
    14·2 answers
  • Which scientist would agree with this statement: Giraffes all had short necks originally. Individual giraffes stretched their ne
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!