1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
What is the source and sink for xylem and phloem?
Strike441 [17]

Answer:

Sap moves through phloem via translocation, the transport of dissolved materials in a plant. Unlike the xylem, which can only carry water upward, phloem carries sap upward and downward, from sugar sources to sugar sinks: Sugar sources are plant organs such as leaves that produce sugars

8 0
4 years ago
All you need is in the photo <br><br>ASAP ​
Novosadov [1.4K]

Answer:

B

Explanation:

4 0
3 years ago
Read 2 more answers
A neap tide occurs when:
AveGali [126]
Should be the moon moves 90 degrees in it I wish you best of luck
5 0
3 years ago
What type of galaxy is the milky way
harina [27]

Answer:

Barred Spiral

Hope this helps!

3 0
3 years ago
I need help!!!!!!!!!!!!!!!!
ale4655 [162]

<em>Answer:</em>

C. Many, many years of deposition

<em>Explanation:</em>

The layers of the rocks in one region of the parks are smooth and distinct, which are evidence of many, many years of deposition.

The layers on the rocks are because of different deposition of sediments. Different sediments deposited over the rocks through the wind, water, and ice over the ages.

Have a beautiful day.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The upward force exerted on an object falling through air is?
    10·1 answer
  • Muscles help to move different parts of our body. The part that moves
    15·1 answer
  • The ability to change body position and direction quickly and efficiently defines what skill
    15·1 answer
  • What is the difference between lunar and solar eclipse?
    8·1 answer
  • The survival of many plants and animals have been aided most by
    12·1 answer
  • What happens during prophase?
    7·2 answers
  • Review:
    9·1 answer
  • What is the rapid change in a membrane's potential caused by the depolarization of a neuron?
    9·2 answers
  • Would you consider alcohol as food nutrient? explain.​
    14·1 answer
  • Please help me I do not know how
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!