1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
2 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]2 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
If the sequence of bases on one half of a DNA molecule is GATTACA, what is the sequence of bases on the opposite side (from left
AURORKA [14]
The sequence of bases on the other half of the DNA molecule would be CTAATGT from left to right, because each cytosine base pairs with a corresponding guanine base, and each adenine base pairs with a corresponding thymine base. 
4 0
2 years ago
> need help plz it is for my homework...<​
Nastasia [14]
The answer is 120! good luck
3 0
2 years ago
What type of graph is used here to represent the growth of tortoise shells?
NISA [10]
That right there is a line graph
4 0
3 years ago
Ligers are the largest cat in the world that is a mix between a lion and a tiger. This is an example of..
Aleksandr-060686 [28]

Answer:

Cross breeding

Explanation:

8 0
3 years ago
A student put the powder to the corom board . Sciencetific reason for adding powder is ,
kondaur [170]

Answer:

B or D

Explanation:

think of it how you use chalk on a chalk board, its less friction using chalk instead lets say a marker on a white board.

8 0
2 years ago
Other questions:
  • What effect will first-degree burns most likely have on the upper layer of somebody’s skin?
    5·1 answer
  • Living organisms are only able to function and thrive if they can maintain constant or stable internal conditions. This ability
    9·2 answers
  • The _____ , first proposed by ronald melzack and patrick wall, is a current explanation for how pain works
    5·1 answer
  • Where in an embryo are the instructions located for how to build organs?
    12·2 answers
  • How can natural selection affect a predator-prey relationship in an ecosystem?
    14·2 answers
  • What is energy? what is an example of it ?
    11·2 answers
  • The haploid stage in a plant life cycle is called the____________.
    6·1 answer
  • A facility would like to verify each individual's identity prior to allowing access to its server room and datacenter. Additiona
    11·1 answer
  • Lionfish are native to the tropical waters of the Indo-Pacific. What conclusions can be made about the impact of climate change
    9·1 answer
  • Which is NOT a role of the respiratory system(select all that apply)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!