1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
Which biological career professionals were most likely involved in monitoring and enforcing the protection of the bald
alisha [4.7K]

Answer:epidemiologists

Explanation:If a bald eagle gets mostly involved in monitoring and enforcing the protection of the bird it is a epidemiologists.

7 0
3 years ago
What do you call an organism killed by oxygen?​
slava [35]
An organism killed by oxygen is known as obligate anaerobes
8 0
3 years ago
Compare at least two characteristics of mitochondria to prokaryotic cells and explain how this relates to the endosymbiotic theo
Gekata [30.6K]

The endosymbiotic theory stated that the mitochondria of eukaryotic cells are actually prokaryotic bacteria which were once engulfed by prehistoric eukaryotic cells as a result of evolution.

 

Therefore to answer this question, here are some characteristics: 
1 Both mitochondria and prokaryotic cells contain their own DNA.

2 Neither of the two have true nuclei, but they do have a space in which their DNA is enclosed. 
3 Mitochondria and prokaryotic cells have similar transcriptional machinery, which means that they have the same process of making RNA from DNA.

<span>4 Mitochondria contain their own genome, and the formation of their genome in most organisms is circular similar to prokaryotes.</span>

3 0
3 years ago
WILL GIVE A BRANILEST AND 20PTS
Ymorist [56]
Hello Ziplovin31, widespread hunting of predators may result in <span>overpopulation of prey.</span>
7 0
3 years ago
Read 2 more answers
In which structure of the female reproductive system is a zygote typically found?
Karo-lina-s [1.5K]
The answer is A. Fallopian Tube. The ovaries create the egg and the fallopian tubes hold the zygote until it is fertilized, then transfer it to the uterus.
5 0
3 years ago
Other questions:
  • A physician who analyzes cells tissues and organs to diagnose disease is called a
    10·1 answer
  • Match each checkpoint with the action it check for? can any one help me with this ? ​
    12·1 answer
  • Describe an environmental factor that could influence natural selection and decrease genetic diversity. Pick a specific example
    11·2 answers
  • What type of vegetables are high in carbohydrates
    12·2 answers
  • When in england, darwin displayed a wide variety of physical symptoms. these symptoms were probably ___?
    15·1 answer
  • Lampreys and hagfishes have
    7·2 answers
  • Which of the following do you think will contribute to water conservation? A. Planting non-native wetland plants for landscaping
    15·1 answer
  • Where does diffusion of oxygen and carbon dioxide take place in the lungs?
    6·1 answer
  • Facilites diffusion does not need the help of protein?<br><br> True or False ?
    6·1 answer
  • Two lizards with different coloring exist within the same ecosystem. One lives in the trees, and the other prefers hiding among
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!