1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
Cuáles son los alimentos que se deben consumir en menor cantidad
Zarrin [17]

Answer:

candy

Explanation:

ghhjkjgggdddfhu

7 0
3 years ago
In animals, carbon dioxide waste is exchanged for
LUCKY_DIMON [66]

Answer:

oxygen

Explanation:

  • Through the process of respiration , in lung the carbon dioxide from the blood is exchanged with oxygen.
  • The smallest dunctional unit if the lung is the alveoli
  • At this level the gases are exchange through the capillaries present close to the alveoli.
  • The concentration gradient ,meaning the greater amount of oxygen present in the lungs and greater amount of carbon dioxide in the blood creates a gradient that allow the movment of oxygen into the blood and carbon dioxide in the alveoli through the membrane .
  • Partial pressure created allows the easy movement .The carbon dioxide get into the trachea and expelled through nose and mouth.

3 0
3 years ago
What are some differences and similarities between solar energy production and photosynthesis?
Ivahew [28]

Answer:

The main difference between photosynthesis and cellular respiration is that photosynthesis is an anabolic process, where the synthesis of organic compounds occurs, storing energy whereas cellular respiration is a catabolic process, where the stored organic compounds are utilized, producing energy.

Explanation: hope it helps!

7 0
3 years ago
1.What do other organisms rely on plants for?
Black_prince [1.1K]

Answer: Organisms depend on other organisms and on the nonliving things in an ecosystem to meet their basic needs for food, water and protection. 3. Plants use energy from the sun to produce their own food from air and water.

Explanation:

3 0
3 years ago
Read 2 more answers
Imagine that you are walking through a forest on a chilly day, and you can clearly hear the fallen leaves crunch underfoot. this
BabaBlast [244]

Answer: This forest would be located in somewhere like rio

Explanation:

3 0
3 years ago
Other questions:
  • Prokaryotes that are round are called spirochetes. <br> a. True<br> b. False
    11·1 answer
  • While most of the cells in a hair are dead, the living epithelial cells are found in?
    14·1 answer
  • What is used to make the measles vaccine?
    6·2 answers
  • What Must occur for the embryo to be formed
    15·1 answer
  • If a chemical reaction catalyzed by an enzyme is being carried out, and there is a sudden, drastic decrease in temperature, what
    6·2 answers
  • :3<br> what is the biggest cat in the world?
    9·2 answers
  • Which statement below BEST summarizes the role of the DNA molecule in cells?
    8·1 answer
  • If the number of photosynthetic organisms on Earth decreased drastically, which would happen as a result?
    12·1 answer
  • Nondisjunction occurs when chromosomes do not properly separate during cell division, which can lead to?.(please no links just w
    12·1 answer
  • Identify organelles in a plant cell.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!