1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
I can live on the land or water, and I have a lot of cells. I have to consume other organisms , what kingdom am I?
Simora [160]
I believe it would be the reptile kingdom!
6 0
3 years ago
A 35-year-old woman is 1 day postpartum. she is reporting moderate perineal pain after giving birth and would like to clean the
Ainat [17]

A sitz bath  

A sitz bath method of bathing is most appropriate for this client .

A sitz bath is a warm, superficial method of bathing that cleanses the perineum (region between the genital area and the anus). The sitz bath is used when an individual recently give birth or when having discomfort from hemorrhoids. The sitz bath’s warm water promotes healing as it raises blood flow to the perineum. It also provides relief from pain, itching or irritation in the genital area.


5 0
3 years ago
The folded mountains is an example of which type of plate boundary?
Marizza181 [45]

Answer: Contential Crust

Explanation:

6 0
3 years ago
The electromagnetic waves with the highest frequencies are called:
Tasya [4]
The answer is b gamma
3 0
3 years ago
Which type of electromagnetic radiation has a longer wavelength than visible light?
Amanda [17]
There are radio waves, microwaves and infrared waves
7 0
3 years ago
Read 2 more answers
Other questions:
  • What type of vegetation would you expect to find on newly formed volcanic islands?
    11·1 answer
  • 2. What are 3 examples of lipids and what functions do they serve in organisms' bodies?
    10·1 answer
  • Theodor W. Engelmann illuminated a filament of algae with light that passed through a prism, thus exposing different segments of
    7·1 answer
  • Suppose you have identified a type of lizard that seems to have acquired a mutation in which hindlimbs are absent. Which gene, a
    10·1 answer
  • Match each activity to its respective scientific discipline. Drag the items on the left to the correct location on the right.
    12·2 answers
  • Complete the sentence to describe what a wave is and what it does.
    9·1 answer
  • The hereditary information in animal and plant cells is located on chromosomes which are stored in the cells
    10·1 answer
  • Why might some people find it difficult to follow the MyPlate recommendations?
    11·1 answer
  • The parietal bones are firmly interlocked along the midline by the
    12·1 answer
  • In your own words, describe where the action potential begins, and how it travels down the length of the axon. Be sure to includ
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!