1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
2 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]2 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
Which statement correctly describes a step in the carbon cycle?.
elixir [45]

Answer:

Explanation:  step 1 Carbon enters the atmosphere as carbon dioxide from respiration (breathing) and combustion (burning). The Carbon Cycle Step 2 Carbon dioxide is absorbed.

8 0
1 year ago
Which of the following is the definition for speciation?
marshall27 [118]
2. The evolutionary process through which new species emerge

6 0
3 years ago
Read 2 more answers
When examining indentations, document examiners may apply what to help reveal the indentations? an electrostatic charge lighter
Mrrafil [7]
When examining indentations, document examiners may apply ash <span>to help reveal the indentations</span>
8 0
3 years ago
Read 2 more answers
Which statements about the phylogenetic tree are true?
Alex777 [14]

Image is not avilable fo rthe question. The image is attached below:

The phylogenetic tree shown here displays the major clades of chordates.

Which statements about the phylogenetic tree are true?

A) Organism (c) is a common ancestor of lampreys and lungfishes.

B) Birds and ray-finned fishes have a notochord and jaws.

C) Lancelets and coelacanths are more closely related than are chimaeras and coelacanths.

D) Mammals and turtles are more closely related than are lungfishes and sharks.

E) Rays and frogs have vertebrae.

F) Descendants of organism (d) have limbs with digits.

G) Hagfishes, lungfishes, and frogs have lobed fins.

H) Organism (a) is a common ancestor of all chordates.

Answer:

B, D, F, E, H.

Explanation:

A phylogenetic tree is a diagram representing evolutionary relations between species. Phylogenetic trees are not conclusive evidence nor theories. In a phylogenetic tree the pattern of branching illustrates how organisms or other groups developed from a set of similar ancestors.

Some of the examples of phylogenetic tree are as following:

  • A notochord and jaws includes in birds and ray-finned fishes.  
  • Mammals and tortoises are closer to one another than lungfish and sharks are.  
  • Organic Descendants (d) have wings.  
  • Rays and frogs are columned vertebrally.  
  • A shared ancestor of all chordates is the organism (a).

Hence, the true options are B, D, F, E, H.

5 0
2 years ago
Which is a main princip of confucianism ap human geography?
GalinKa [24]
<span>A love for humanity, worship of ancestors, respect for parents, and harmony in thought/action.</span>
7 0
3 years ago
Other questions:
  • H2O Given the chemical formula, how is this substance MOST LIKELY classified? A) atom Eliminate B) compound C) both atom and com
    8·1 answer
  • How meiosis causes cancer?
    10·1 answer
  • Which field of study would be most useful for a person who wants to help preserve a wetland?
    15·2 answers
  • Why did aristotle most likely classify plants by their shape and animals by where they lived
    14·1 answer
  • By the year 1980, a wolf species ( Canis rufus) once common to the southeastern region of the United States disappeared from all
    11·1 answer
  • Explain what asexual reproduction is and list the 5 different types that exist.
    7·1 answer
  • What often happens to rocks that undergo chemical weathering?
    10·1 answer
  • I really need help ASAP!!
    10·1 answer
  • Using your understanding of diffusion, how do you think oxygen from our lungs is transported to our red blood cells?​
    15·1 answer
  • Which RNA types are involved in translation?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!