1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
If a promoter is found within a nucleosome, how would it be possible to express that gene if needed?
SIZIF [17.4K]

Answer:

A) special proteins would open the promoter while

Explanation:

A promoter is an area of DNA that can be bound to be proteins in order to initiate processes such as transcription. These sequences are usually a repetitive code.

---------I HOPE IT HELPS-----------

7 0
3 years ago
1. The drug is effective when its concentration is at or above 70 mg/ml. For what length of time is the concentration at or abov
almond37 [142]
45mg/ml is the disheveled Hagen jags
4 0
3 years ago
I´ll give brainliest to the correct and most helpful answer!
IceJOKER [234]
I believe it would be proteins
5 0
3 years ago
Read 2 more answers
. Explain how the mouse population might be affected if the owl population tripled.<br> I
Naily [24]

Answer:

The mouse population would be affected because of the relationship between mice and owls have in the food chain is competitive, thus meaning the mouse population would decrease.

Explanation:

4 0
3 years ago
If you were to rub your finger over the surface of your face, you would notice that the skin is oily. what makes up the oil
kumpel [21]
 Ruptured cells from sebaceous glands
7 0
4 years ago
Other questions:
  • What may happen if a pollutant manufacturing waste and pesticides enter the ground water
    6·1 answer
  • If a nerve cell receives many ipsps in different locations at the same time, ____
    5·1 answer
  • The recommended daily allowance (RDA) of the trace metal magnesium is 410 mg/day for males. Express this quantity in μg/day.
    6·1 answer
  • How do aquatic factors affect the distribution of aquatic life. Include biotic and abiotic factors. Please help. Thanks
    13·1 answer
  • Photosynthesis is a process in which plants prepare food using carbon dioxide, chlorophyll, and water in the presence of sunligh
    8·2 answers
  • Review the equation at the bottom of of page 505 paraphrase this equation
    13·1 answer
  • Alleles A and a reside at a locus on the same chromosome as a locus with alleles B and b. Aa Bb is crossed with aa bb and the fo
    6·1 answer
  • Which of the following structures collects the depolarization wave from the atria to pass it onto the ventricles?
    5·1 answer
  • What is made up of a phosphate a sugar and a base?
    10·2 answers
  • Which statement is correct regarding the semiconservative nature of DNA?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!