1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
7

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Biology
1 answer:
Lorico [155]3 years ago
5 0

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

You might be interested in
Most neurodegenerative diseases involve inability to remove misfolded/aggregated proteins. The cellular organelle that often fai
klasskru [66]

Answer: c. proteasome

Explanation:

Proteasomes are extremely important multi-catalytic proteases and are involved in various cellular functions. The proteasome is an essential component of eukaryotic cells and is responsible for the ATP-dependent proteolytic degradation of most cellular proteins. They are present in the nucleus and cytosol and can represent up to 1% of total cell proteins. Proteasomes generally degrade proteins to small peptides, most of which are rapidly hydrolyzed by cytoplasmic exopeptidases. It catalyzes the rapid degradation of many enzymes, regulatory proteins, and eliminates abnormal proteins resulting from mutation or damaged proteins. The inability of this cellular organelle can lead to neurodegenerative diseases, such as Parkinson´s disease.

8 0
3 years ago
Asexual reproduction produces _____.
Sauron [17]
Asexual reproduction produces <span>a direct clone of the parent.
The other terms are related to sexual reproduction.

Asexual reproduction or asexual reproduction is a mode of reproduction, which (as opposed to sexual reproduction) corresponds to the capacity of living organisms to multiply alone, without a partner, without involving the fusion of two gametes of opposite sexes.

The mechanism of the reproduction is by </span>mitosis, <span /><span>budding or </span>scissiparity.<span>
</span><span>
</span>
3 0
3 years ago
A hydrophobic amino acid r group (side group) would be found where in a protein?
kumpel [21]
E. On the inside of the folded chain, away from water.
6 0
3 years ago
Read 2 more answers
Compare and contrast. what three elements do all macromolecules share? explain how the chemical properties of lipids, nucleic ac
inn [45]

All macromolecules have carbon atom and the hydrogen atom.

<h3>What are macromolecules?</h3>

The term macromolecules refers to the molecules that are composed of smaller units. These smaller units are called monomers. The macromolecules that we are concerned with here are the macromolecules that could be found in the human body.

The biological macromolecules are often very large as we can see. This is because the number of units that are joined to form the macromolecules are usually very much. There are thousands of monomer molecules that are joined together to give proteins, lipids, carbohydrates and the nucleic acid macromolecules.

All the macromolecules have the carbon atom and the hydrogen atom. These are found across all the macromolecules. The carbohydrates are reducing sugars thus they contain the carbonyl bond. The carbonyl group is absent in lipids, nucleic acids, proteins, and amino hence they do not undergo carbonyl reduction reactions.

Learn more about macromolecules:brainly.com/question/15237842

#SPJ1

3 0
1 year ago
What happens to light when it changes mediums
ryzh [129]

Answer:

Refraction is an effect that occurs when a light wave, incident at an angle away from the normal, passes a boundary from one medium into another in which there is a change in velocity of the light. ... The wavelength decreases as the light enters the medium and the light wave changes direction.

7 0
2 years ago
Other questions:
  • What are three examples of matter besides water that are transported through ocean currents
    8·1 answer
  • There are some kind of nails on its sole of soccer shoes.What is the function of them?
    7·1 answer
  • DNA replication occurs during which phase of the eukaryotic cell cycle?
    13·1 answer
  • You are researching a cytoplasmic protein associated with a nerve disorder. The native form of the enzyme appears to be globular
    6·1 answer
  • Which substrate is digested by the enzyme protease?
    7·2 answers
  • Polysaccharides have _____sugar(s); disaccharides have _____sugar(s); monosaccharides have _____sugar(s).
    13·2 answers
  • How does the structure of your DNA determine your traits?
    5·1 answer
  • Which of the following contributes to the desertification of the land?
    12·2 answers
  • Why does meiosis and mitosis Involves DNA and Chromosomes
    5·1 answer
  • James fills a graduated cylinder with 50 mL of water. He then drops a 60g key into the graduated cylinder. The water level insid
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!