All categories

3 years ago

What is not a characteristic of life

Biology

1 answer:

kirza4 [7]3 years ago

6 0

Answer:

All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life

You might be interested in

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

PARTA

erastovalidia [21]

Answer:

A. The bacteria are breaking down sugars in the absence of oxygen.

Explanation:

Bacteria are microscopic single-celled organims. These organisms may produce their own source of chemical energy, or consume and absorb chemical energy made by producers.

They break down chemical energy like glucose through lactic acid fermentation in their cytoplasm, without the presence of oxygen.

In Glycolysis:

2 molecules of ATP are used to break up glucose into 2 molecules of pyruvate, 4 ATP and 2 electron carrying NADH molecules. Since 2 ATP are used, a net 2ATP are produced by this process.

Then, pyruvate is converted to lactic acid, producing 2 NAD+, used as electron carriers.

6 0

3 years ago

Read 2 more answers

Ben was studying conjugation in prokaryotes. He learned that prokaryotes attach themselves to each other and exchange genetic in

Nat2105 [25]

The correct option is C.
Pilli is a long protein filament which attach reproducing cells together during conjugation. This attachment allows the cells to exchange the genetic materials, that is, plasmid between them.

8 0

3 years ago

The nurse has a prescription to give a first dose of hydrochlorothiazide to an assigned client. the nurse would question the pre

Monica [59]

Sulfa drugs, such as antibiotics that contain sulfonamides. Example: Some combination drugs such as Sulfamethoxazole-trimethoprim (Septra, Bactrim) and Erythromycin-sulfisoxazole contain sulfonamides.

5 0

3 years ago

Silicon dioxide forms the cell walls of _____. diatoms insects plants

Keith_Richards [23]

Silicon dioxide forms the cell walls of diatoms. These diatoms are a group of algae. Phytoplanktons are the most common types of diatoms that are unicellular. These organisms can form colonies in the shapes of filaments or ribbons, fans, zigzags, and stars that are perfect for monitoring environmental conditions, particularly water quality in the past and present.

8 0

3 years ago

Read 2 more answers