1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
3 years ago
11

What is one observable adaptation of the redbud tree that makes it a member of the legume family?

Biology
1 answer:
Step2247 [10]3 years ago
6 0

Answer: I think one observable adaptation of the redbud tree that makes it a member of the legume family is the shape of the fruit.

Explanation: Different species might look dissimilar but the unity among organisms becomes apparent from an analysis of internal structures, the similarity of their chemical processes, and the evidence of common ancestry

You might be interested in
Research a tundra plant or animal that is being affected by climate change. What is the name of it? Where on Earth does it live?
Sonbull [250]

Answer:

Green turtles live in Tropical Ocean Waters they are affected by climate change, because sea levels rise and stronger storms will erode and destroy there beach habits.  

Explanation:

Couldn't find the outlook :)

6 0
2 years ago
Read 2 more answers
PLEASEE HELLLPPPP!!!!!
Nezavi [6.7K]

Answer: I believe that the answer is D.

Explanation:

5 0
3 years ago
The first step to begin digestion of food starts with the _____
babunello [35]
The first step begins with: A. the mouth.
4 0
3 years ago
Read 2 more answers
The advantage of using a scale model?
skad [1K]

Answer:

H. It represents the actual size but it is big enough for the eye to see making it extrememly accurate

Explanation:

6 0
3 years ago
Read 2 more answers
What are the important events and end products of light reaction
german

Answer:

The important events of light reaction are (i) Excitation of chlorophyll molecule to emit a pair of electrons and use of their energy in the formation of ATP from ADP + Pi. This process is called photophosphorylation. Splitting of water molecule (a) (b) End products of light reaction are NADPH and ATP.

3 0
3 years ago
Read 2 more answers
Other questions:
  • If forests serve as important sinks for greenhouse gases, describe how past ice ages might have affected the concentration level
    6·1 answer
  • __________ are secreted by cells infected with viruses, alerting neighboring cells and protecting them from becoming infected.
    6·1 answer
  • You are investing your resources in a college education because A. you have no opportunity cost for the use of your time. B. the
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is an example of temporary change
    12·2 answers
  • A pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance
    7·1 answer
  • A hand lens or magnifying glass is strong enough to view cell organelles.<br><br> True<br> False
    5·1 answer
  • Explain how the theory of evolution is supported. (list and describe each evidence)
    13·2 answers
  • How does the structure of dna encode genetic information?
    9·1 answer
  • Match each description with the appropiate item.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!