Most climate scientists agree the main cause of the current global warming trend is human expansion of the "greenhouse effect" — warming that results when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping. HOPE THAT HELPS
Answer: ochers
Explanation: they mixed ocher with iron
The correct answer is c. Please give me brainlest let me know if it’s correct or not okay thanks bye
Answer:
The shrimp population in a bay
Explanation:
Biotic factors are the living component of an ecosystem. These include the plants and animals that inhabit the area. The rest of the choices are the abiotic factors which describe the non-living component of an ecosystem. Abiotic and biotic factors are interrelated and together help to form an ecosystem and biome.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150