1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeyben [28]
3 years ago
5

A certain mRNA molecule has the following sequence:

Biology
1 answer:
jarptica [38.1K]3 years ago
7 0
A. There are 4 codons
Idk B
You might be interested in
Which of the following scenarios is the best example of a close-to-home environmental issue?
anygoal [31]
A I believe because cars produce a lot of gas contributing to global warming
6 0
3 years ago
The steps in which solar wind is formed
melomori [17]
Solar wind is a stream of charged partials released from the upper atmosphere of the sun. this plasma consists of mostly of electrons, protons and alpha partials with thermal energys betwqeen 1.5 and 10 kev
5 0
3 years ago
Select all that apply.
ArbitrLikvidat [17]
Pollen....because cones are absent in angiosperms.....flowers are absent in gymno....and seeds are also absent in gymno sperm........so and is pollen !
6 0
3 years ago
Read 2 more answers
When the condenser airflow is restricted,
stepladder [879]
D. Low side pressure is high and high side pressure is low
4 0
3 years ago
Read 2 more answers
Which has a greater density, a 1 kg pure gold chain or a 20 kg piece of pure gold bar?
antiseptic1488 [7]

20kg piece of pure gold, i think........

7 0
3 years ago
Other questions:
  • Which are different forms of the same gene?
    7·2 answers
  • What happens to a ray of light that passes through a lens?
    9·2 answers
  • Which of these is an environmental effect of burning fossil fuels and pesticides from farming?
    9·2 answers
  • Plants use photosynthesis to meet their survival needs by enabling them to
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • All of earth's water, land, and atmosphere within which life exists is known as
    13·1 answer
  • What are the parts of a plankton ?
    6·1 answer
  • Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
    6·1 answer
  • 2. How has scientific understanding about the composition of the universe changed over time? Select the two correct answers.
    15·1 answer
  • An extension past the anatomical position is known as
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!