1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svet_ta [14]
3 years ago
8

The ______ theory of color vision holds that we perceive colors because of pairs of receptors that make antagonistic responses.

Biology
2 answers:
ElenaW [278]3 years ago
7 0

Answer is opponent-process theory.

Further explanation

Color vision

Color vision is a capacity to see contrasts between light made out of various wavelengths freely of light force. Shading recognition is a piece of the bigger visual framework and is intervened by a mind complex process between neurons that starts with differential stimulation of various kinds of photoreceptors by light entering the eye. Those photoreceptors then transmit yields that are then engendered through numerous layers of neurons and afterward at last to the cerebrum.

Color blindness

Such condition in which an animal cannot differentiate in colors.

Types of color vision

Monochromacy

It is in marine mammals.

Dichromacy

It is present in non-primate mammals.

Trichromacy

It is seen in primates.

Tetrachromacy

Mostly in amphibians and reptiles.

Pentachromacy

Mostly in birds and insects.

Theories of color vision

Color vision theories are following .

Trichromatic Theory

The trichromatic theory of color vision, otherwise called the Young-Helmholtz hypothesis, expresses that the retina has three receptor cells, which respond to light of three unique wavelengths - red, green and blue. These cells are in charge of the impression of colors.

Opponent-Process Theory

Given by Ewald Hering, the adversary procedure hypothesis expresses that the cone photoreceptors are connected together to frame three contradicting shading sets: blue/yellow, red/green, and dark/white. Initiation of one individual from the pair restrains action in the other. Predictable with this hypothesis, no two individuals from a couple can be seen at a similar area, which clarifies why we don't experience such hues as "somewhat blue yellow" or "red green". This hypothesis likewise clarifies a few sorts of shading vision inadequacy. For instance, individuals with dichromatic lacks can coordinate a test field utilizing just two primaries. Depending upon the lack they will confuse either red and green or blue and yellow.

Answer details

Subject: Biology

Level: High school

Key words

  • Color vision
  • Color blindness
  • Types of color vision
  • Monochromacy
  • Dichromacy
  • Trichromacy
  • Tetrachromacy
  • Pentachromacy
  • Theories of color vision
  • Trichromatic Theory
  • Opponent-Process Theory

Learn more to evaluate

brainly.com/question/12887489

brainly.com/question/10560288

brainly.com/question/12603071

Sergio [31]3 years ago
6 0
The Opponent-Process theory of color vision holds that we perceive colors because of pairs the receptors that make antagonistic responses. <span />
You might be interested in
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
What caused the formation of the moons layer
vova2212 [387]

Answer:

when an object smashed into early Earth. .Explanation: no explanation just the answer

7 0
3 years ago
PLEASE HELP!
mel-nik [20]

Answer:

Although elephants and hyraxes at first don't seem to have many similarities, a closer look has led many scientists to believe that these animals are evolutionarily closely related.

Elephants and Hyraxes share many reproductive characteristics that indicate a common ancestor: The location of the testicules in these animals diverges from most mammalian species, remaining inside the retroperitoneal abdomen. Females have similar placental origins and long gestation periods and the location of the mammary glands in both orders (above the front legs) is a unique feature among non-primate mammals. Hyraxes' tusks develop from incisor teeth, similar to elephants, and in both cases nails develop into flattened, hoof-like structures.

Molecular evidence has also been used to confirm the hypothesis of evolutionary relatedness between the two orders, as similarities in some gene sequences in mitochondrial DNA and other molecular components. Both animals have some physiological similarities and cognitive characteristics (such as the presence of a powerful long-term memory) that support the possibility of evolutionary proximity.

The fossil record indicates that in the Eocene period hyraxes were dominant herbivores in Africa, with several species, reaching much larger sizes than today and occupying different ecological niches, indicating that elephants and hyraxes may have been very similar millions of years ago.

3 0
3 years ago
Read 2 more answers
Which of the following is true about reproduction that involves meiosis?
irakobra [83]

<u>The offspring are genetically unique.  </u>

Answer: Option C

<u>Explanation:</u>

Meiosis is a form of cell division that is concentrated towards the reproductive cells. In this cell division the diploid cells (two sets of chromosomes) undergo reduction to form a haploid cell (one set of chromosome). The haploid cell produces sperms and eggs.

Meiosis occurs in two levels Meiosis I and II. Chromosomal segregation happens during meiosis I and II to produce a genetic diversity. The important net result obtained by the meiosis is to produce a genetically unique offspring.

5 0
2 years ago
Can an organ belong to more than one system? Why?
yulyashka [42]
Yes an organ can belong to more than one system because the organ system is the digestive system.
4 0
3 years ago
Other questions:
  • A weather map is an example of a
    15·2 answers
  • A rectangle 10 ×9×18 surface area<br>​
    5·2 answers
  • What are three ways in which carbon dioxide is put back into the earth?
    14·1 answer
  • One of the biggest problems facing underseas exploration is: A.lack of interest B.underwater pressure C.extreme cold temperature
    10·2 answers
  • A yellow powder and a blue liquid are shaken together in a test tube to produce a clear green mixture that is all liquid.which o
    11·1 answer
  • 2. If brown (C) Cows are dominant to white (c) cows, then what color cow will the genotype
    13·2 answers
  • Autoclaving is the most effective among all moist heat-related antimicrobial methods. (True or False)
    9·1 answer
  • How would the decimal point move to solve the equation 124 ÷ 10 to the power of 1?
    9·1 answer
  • Should the nation of warring wizards be considered a nation. why or why not
    7·1 answer
  • 4. If eutrophication is severe, the water body may no
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!