1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tomtit [17]
3 years ago
11

A t cell is a type of white blood cell that has surface receptors that recognize antigens. does an individual t cell have the ab

ility to recognize more than one type of antigen? explain your answer.
Biology
1 answer:
arsen [322]3 years ago
6 0
No. The T-cell has surface receptors made of proteins that are COMPLEMENTARY to only ONE SPECIFIC antigen due to the specific sequence of amino acids resulting in a specific tertiary structure of the protein. Thus, the T cell will only recognise the antigen it’s receptors are complementary to.
You might be interested in
Which statement could be categorized only in the anaerobic section of the Venn diagram?
Alex777 [14]
The answer is letter B has commercial uses such as Alcohol production and bread making. 
7 0
3 years ago
Read 2 more answers
WILL MARK BRAINLIEST IF ANSWERED CORRECTLY!!!!!!!!
Lerok [7]

Answer:

The volume of pollutants decrease in the ecosystem

6 0
4 years ago
Read 2 more answers
1) All of the scenarios are examples of evolution with the EXCEPTION of the A) loss of hind limbs by whales. B) gradual loss of
Whitepunk [10]
C is not an example of evolution so that is your answer
4 0
3 years ago
Read 2 more answers
Why are gram positive bacteria resistant to the effect of membrane attack complex (MAC)? ​
elena-s [515]
Don’t click the link it’s some kind or tracking I did it don’t do it
8 0
3 years ago
Many cows are given antibiotics as part of their regular diet. It has been determined that these antibiotics can be detected in
Lyrx [107]

Answer:

quite simple the antibiotics will be passed off into the yogurt and it may have a healthy affect on humans or harmful, however if healthy it might be promoted as an ad

Explanation:

3 0
3 years ago
Other questions:
  • The nurse obtains a laboratory report that shows acid-fast rods in a client's sputum. which disorder should the nurse consider m
    10·1 answer
  • Pleaseeee help!!!!!!!! I will mark you as brainlinest for correct answer!!!!!!!!!!
    14·1 answer
  • True or False - Velcro was an invention that was originally used for space missions that is now used for things on Earth.
    9·1 answer
  • The biceps femoris muscle's name gives us information about it. What does the word "femoris" in its name tell us? A. Its general
    6·1 answer
  • What steps are necessary before a hypothesis can be formulated.
    6·1 answer
  • The rate of diffusion in a semisolid medium was not effected by the density of the potassium permagenate crystals True False
    5·1 answer
  • SEND HELP ASAP PLEASE IM BEGGING
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Help please will give brainliest to anyone who is good at ​
    13·1 answer
  • The concept that the distribution of one chromosome does not affect the distribution of any other chromosome during meiosis is k
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!