<span>The natural selection.
Natural selection is the differences in survival and reproduction as the consequence of differences in phenotypes.
In natural selection, genotype variations that will increase the chance of survival and reproduction of some organism are preserved and will be inherited. So genotypes variations are responsible for phenotypes and, thus, help the survival of species in a particular location.</span>
Answer:
Heat
Explanation:
Heat makes you start sweating which warms your body up, which makes your cells up.
Animals have cell respiration. But animals don't do photosynthesis because photosynthesis is energy from the sun, we don't get energy from the sun we get it from the food we eat
Answer:
Exothermic because it doesn't take place inside something, rather on the outside. :)
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
