1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mkey [24]
3 years ago
6

When a scientist serves in an enviromental advisory role to society he or she must do what

Biology
1 answer:
aleksklad [387]3 years ago
4 0
Jvruvfvjjjjvxbjjfbbfbfb
You might be interested in
The endocrine system sends chemicals called __________ through the __________ to change short-term and long-term activities in t
S_A_V [24]

Answer: The endocrine system sends chemicals called hormones through the bloodstream to change short-term and long-term activities in the body

Explanation: Endocrine system is a system made up of glands that produce and secrete chemical signal called hormones which travel through the bloodstream to the target cell where they exert their effects.

A hormone is a chemical messenger secreted by an endocrine gland. Long-term activities in the body influenced by hormones include growth and development.

7 0
2 years ago
For the individual with type 2 diabetes, the immediate problems brought about by hyperglycemia can lead to which of the followin
Minchanka [31]

Answer:

option d is correct

Explanation:

8 0
3 years ago
What can be predicted for a child who received a dominant allele for "tallness" from one parent and a recessive allele for "shor
DerKrebs [107]
The child would possibly still be considered as tall because the tall genes is Dominant, and the only way that recessive allele is selected is when the child receives two recessive allele
3 0
3 years ago
If the producer population in an ecosystem decreased, what would most likely happen to the size of the herbivore population?
yulyashka [42]
The herbivore population would starve and decrease as well.
5 0
3 years ago
Read 2 more answers
Due to the presence of mycolic acids in the cell wall of Mycobacterium spp., the ________ staining procedure can be used as a di
UNO [17]

The question is incomplete as it does not have the option which are:

-acid-fast

-DAPI

-lipo

-Gram

Answer:

Acid-fast  staining

Explanation:

Acid-fast staining is the technique used to stain and identify the species of the mycobacterium.

During the acid-fast staining, the carbolfuchsin stain is used to color the bacteria as carbolfuchsin solubilizes the lipid of the bacterial wall and the pink stain enters the cell. When these cells are treated with the methylene blue counterstain, the mycobacterium due to the presence of thick cell wall does not allow the entry of the methylene blue as a result of which they appear red o pink.

Thus, acid-fast staining is correct.

6 0
3 years ago
Other questions:
  • This cell membrane gateway system is specifically called the
    7·2 answers
  • What are the properties of a useful model of global systems
    12·1 answer
  • Which of the following best defines iconoclast?
    7·2 answers
  • What do whooping cranes need to obtain from their habitat
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • If in any organism a DNA molecule is 24% cytosine, how much adenine will thay DNA molecule contain?
    14·2 answers
  • HELP it is late work i need help
    7·1 answer
  • Cumulative Exam Review Active 21 22 23 Examine the weather map. Which high-temperature range is most likely represented by the s
    14·2 answers
  • Why is solar energy not distributed evenly over earth? Give at least THREE factors/reasons why.
    10·1 answer
  • Why is evolution so important for understanding biology? Explain your answer in 1-2 sentences.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!