1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vanyuwa [196]
3 years ago
8

predict the shape of a population growth curve for a game park in which a male and female rhinoceros are released

Biology
1 answer:
FromTheMoon [43]3 years ago
7 0
Nearly flat. Rhinos don't really reproduce rapidly.
You might be interested in
Match each of the following terms with its definition. 1. Mitosisa) The dense, active protoplasm found in the center of the cell
Andru [333]

Answer:

1. Mitosis c) The process of cell reproduction of human tissues that occurs when the cell divides into two identical cells

2. Nucleus a) The dense, active protoplasm found in the center of the cell

3. Cytoplasm b) The watery fluid that surrounds the nucleus of the cell and is needed for growth, reproduction, and self-repair

4. Cell membrane d) The part of the cell that encloses the protoplasm and permits soluble substances to enter and leave the cell

Explanation:

  • Mitosis is the process that undergoes a cell to give two new identical cells. This is how our body makes or renovates tissues.
  • The nucleus is the part of the cell that contains the DNA, which is necessary to synthesize the proteins that the cell and our body need. It is in the center of the cell and has a nuclear membrane that separates it from the rest of the organelles.
  • The cytoplasm is a solution that surrounds the nucleus, and it contains the rest of the organelles that the cell needs for its functions.
  • The cell membrane is the structure that encloses all the cytoplasm and the nucleus. It is made of phospholipids, proteins, and cholesterol, which allows the passage of certain substances.
6 0
2 years ago
Definition: This is a machine that converts electrical energy into mechanical energy.
scZoUnD [109]
A motor converts electrical energy into mechanical energy. Think of a car, it burns fuel (electrical energy) and turns it into tire spinning (mechanical energy)
3 0
3 years ago
Read 2 more answers
I NEED HELP THIS IS DUE IN LIKE 10 MINUTES OML
fiasKO [112]

Answer:

1.A tissue is a collection of similar cells that work together to perform a specific job.

An organ is a collection of different tissues that work together to perform a specific job. The function of a part of an organism is what it actually does (it's job)

2.The structure of the alveoli as a web of blood vessels surrounding an air sac allows blood cells take in oxygen and bring it into the lungs (organ)

4 0
3 years ago
Read 2 more answers
The sensory cells associated with this sense actually hyperpolarize in response to their stimulus modality...
vaieri [72.5K]

Answer:

Vision

Explanation:

Sensory cells may detect the information like taste, touch, hear and vision by the presence of receptors located on their surface.

Hyperpolarisation may be defined as the change in the cell's membrane potential towards more negative. The sensory vision cells are associated with the hyperpolarisation of cells and makes the cells environment more negative  in response to the stimuli.

Thus, the correct answer is option (d).

8 0
3 years ago
How do organ systems work together to deliver nutrients from food throughout the body?
Travka [436]

D- The digestive system breaks down your food and your circulatory system takes it throughout your body

4 0
3 years ago
Read 2 more answers
Other questions:
  • 2 Points
    8·1 answer
  • During the contraction of a vertebrate skeletal muscle fiber, calcium ions _____.
    8·1 answer
  • Please help
    9·2 answers
  • What is an important molecule that is produced during photosynthesis
    5·1 answer
  • Which characteristics is mostly to be found in a mushroom but not found in Thermus aquaticus
    9·1 answer
  • As intense pressure is placed on the planet's limited resources, businesses are again turning to technological innovation. New a
    8·1 answer
  • Homogeneous materials contain visibly different materials. True or False
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Bicoid mRNA is expressed in a gradient in Drosophila embryos. Loss of Bicoid function leads to embryos with two posterior ends.
    9·1 answer
  • Where do the decomposers come in the food chain if the pyramid gose like
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!