1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergij07 [2.7K]
3 years ago
9

Bicoid mRNA is expressed in a gradient in Drosophila embryos. Loss of Bicoid function leads to embryos with two posterior ends.

If researchers injected bicoid mRNA into the posterior end of an embryo with no bicoid function, the embryo would most likely develop _.
A normally B with two posterior ends C with two anterior ends D with no anterior–posterior body axis
Biology
1 answer:
Veronika [31]3 years ago
6 0
<h2>Option (C) is Right Answer</h2>

Explanation:

    C with two anterior ends

  • Bicoid mRNA is actively limited to the anterior of the organic product fly <em>egg during oogenesis </em>along microtubules by the <em>engine protein dynein,</em> and held there through relationship with cortical actin
  • Interpretation of bicoid is managed by its <em>3' UTR and begins after egg deposition</em>
  • <em>The posterior region</em> (counting the hindgut) grows and stretches out towards the <em>anterior pole</em> along the dorsal side of the incipient organism
  • Segments of the incipient organism become <em>noticeable, making a striped course of action along the anterior-posterior axis</em>
You might be interested in
What was the purpose of the apollo space missions
Yakvenalex [24]

Moon! The Apollo missions were to go to the moon hope this helps

5 0
2 years ago
Read 2 more answers
A short handled tool used in loosening the soil around the plants.
Natali5045456 [20]
The answer is a trowel.

-Evidence—
•-A trowel is a small hand tool used for digging, applying, smoothing, or moving small amounts of viscous or particulate material. Common varieties include the masonry trowel, garden trowel, and float trowel.
5 0
2 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
2 years ago
What enzyme catalyzes the attachment of an amino acid to trna?
3241004551 [841]
The answer is an aminoacyl-tRNA synthetase.

<span> The aminoacyl-tRNA synthetase is an enzyme responsible for the attachment of an amino acid to tRNA. First, it binds the ATP and the amino acid which results in aminoacyl-AMP and inorganic pyrophosphate. Aminoacyl-AMP binds the appropriate tRNA molecule. The aminoacyl group dissociates from the complex with AMP and binds the tRNA molecule creating aminoacyl-tRNA.</span>
7 0
3 years ago
These structures work to filter our CSF into the dural sinuses such as the superior sagittal sinus
Nastasia [14]

Answer:

The answer is B) arachnoid granulations

Explanation:

Arachnoid Mater and CSF Circulation:

  • The arachnoid is the middle layer of the meninges which are the membranes covering the brain.
  • The arachnoid is characterized by the spider web like projections that extend between it and the pia mater (outer membrane of the meninges).
  • These projections are located in the subarachnoid space (space below the arachnoid). These projections contain the circulating cerebrospinal fluid or CSF.
  • The arachnoid extends into the dural sinuses through the arachnoid granulations in which the CSF is filtered and added to the blood for drainage from the brain.
4 0
2 years ago
Other questions:
  • Do organisms within a population compete to survive
    14·1 answer
  • What biomes receive less then 100 Cm of rain each year? Check all that apply
    12·1 answer
  • An organism has a diploid number of 60. What is the organism's haploid
    7·1 answer
  • Knowing what we know about the link between genetics, environment and intelligence, what would be your expectations if you were
    9·1 answer
  • The primary auditory cortex is located within the _____ cortical lobe.
    15·1 answer
  • explain some of the various medieval literary forms. why were writers employing these literary forms?​
    12·1 answer
  • You have a 12 sided cube that is numbered from 1 to 12. what is the probability of rolling a 5?
    12·1 answer
  • Which one of the following sentences contains an incorrect usage of the singular possessive?
    6·2 answers
  • Can someone do this for me on paper
    9·1 answer
  • What molecule is made when you take a phosphate off of ATP? (full name)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!