1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Place the following events in muscle contraction in the correct sequence from first to last. 1. ATP binds to myosin head. 2. Myo
sladkih [1.3K]

Answer:

The correct sequence of muscle contraction from first to last is given below

Explanation:

step 1  myosin head interacts with actin

step 2 ATP binds to myosin head

step 3  ATP is converted to ADP and Pi

step 4  ADP and pi are released from myosin

step 5  Myosin head pivots in the power stroke

step 6  Myosin head is cocked back.

7 0
3 years ago
How do viruses disrupt homeostasis in their host?
Ber [7]

Answer:

Hence, during infection in vivo, a noncytopathic virus may turn off the "differentiation" or "luxury" function of a cell while not killing that cell (loss of vital function). This is turn can disrupt homeostasis and cause disease

hope it helps you

3 0
3 years ago
Read 2 more answers
Which of the following is a surface event that takes place during the rock cycle?
taurus [48]
The erosion I believe
7 0
2 years ago
Read 2 more answers
4. Monosaccharides are to polysaccharides as
vova2212 [387]

Answer:

C

Explanation:

C

8 0
2 years ago
In fruit flies, straight wings are dominant and curly wings are recessive. What will the generations look like? Assume that Mend
Hunter-Best [27]

Answer: There will be one homozygous straight wing, two heterozygous straight wings, and one homozygous curly wing.

Explanation: A true breeding pair means that both parents are heterozygous (Ww). Set up a Punnett square with two Ww parents. The offspring will be 1 WW (homozygous straight), 2 Ww (heterozygous straight), and 1 ww (homozygous curly).

3 0
3 years ago
Other questions:
  • Genetically modified food can unexpectedly appear in
    9·1 answer
  • Label the steps for protein synthesis in order, beginning with the first step
    7·2 answers
  • What is the ratio of C, H, and O in monosaccharides?
    11·1 answer
  • When sugars polymerize in long chains, they may form any of the following except:
    9·2 answers
  • Body parts that work in pairs to help your body parts move
    15·2 answers
  • Why does the Moon have a greater influence on Earth's tides than the Sun does?
    5·2 answers
  • The sun's energy comes from
    9·1 answer
  • How could i get a 79 & all the answer i had was from here
    5·2 answers
  • How many total atoms are in one molecule of sodium nitrate,
    10·1 answer
  • Compare the two DNA sequences. How many of the DNA codons (sets of three nucleotide bases) are different between the two sequenc
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!