1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
How can two organisms have the same phenotype but different genotypes?
balu736 [363]

Two organisms have the same phenotype but different genotypes when One organism is purebred dominant, and the other organism is heterozygous. So, the correct option is B.

<h3>What do you mean by Genotype?</h3>

Genotype may be defined as the ultimate combination of those alleles which are selected for specific studies.

When an allele is dominant over others, its purebred dominant and heterozygous (hybrid) may have different genotypes but the same phenotype.

Therefore, the correct option for this question is B.

To learn more about Genotypes and phenotypes, refer to the link:

brainly.com/question/22117

#SPJ1

7 0
2 years ago
I need 10 interesting facts about Oviraptor? Please
Norma-Jean [14]
Oviraptor means "egg theif"

Oviraptors could have 20 eggs at a time

They lived in Mongolia

The aren't necessarily true raptors

Oviraptors were about 6 - 8 feet tall

The first oviraptor was found in 1924 (i believe)

Oviraptors lived in the Cretaceous period.

Oviraptors most likely weighed 60 - 70 pounds.

They were renamed, as "ovinutrix"

The first fossil of oviraptors was found with eggs.

Brainliest please?


6 0
3 years ago
A process that cannot produce genetic variation in bacterial populations is Group of answer choices transduction conjugation mut
Mila [183]

Answer:

D meiosis

Explanation:

they are as exual and do mitosis

4 0
3 years ago
Since the plasma membrane blocks the passage of all but a few molecules with specific traits it is necessary for the other molec
horsena [70]
No- the question isn’t too clear but since the plasma membrane is the only part of the cell responsible for movement of molecules, there doesn’t need to be other molecules to replicate the same process
4 0
3 years ago
Read 2 more answers
What is the molecular tool that can cut dna at specific recognition sequences so a gene of interest can be inserted into a plasm
Dmitrij [34]
Answer:
Restriction Enzymes (also called biological/molecular scissors)

7 0
2 years ago
Other questions:
  • How do chemical weathering processes differ from mechanical weathering processes?
    8·1 answer
  • Number of species in archaebacteria
    14·1 answer
  • During the process shown above, the two strands of one dna molecule are unwound. then, dna polymerases add complementary nucleot
    13·2 answers
  • Model the stages of the breakup in Pangea, Describe each stage.
    15·1 answer
  • A type of organism that no longer exist on earth is said to be
    9·2 answers
  • In which biome is evaporation greater than rainfall?
    10·1 answer
  • How is the epithelium suited for the substances ?
    12·1 answer
  • Piper touches a block of ice, and she feels that it is very cold. How does she feel the sensation of cold?
    11·1 answer
  • Based on the figure above, _________ATP molecules are formed by fermentation.
    9·1 answer
  • A child who has a mental age of 9 and a chronological age of 10 will have an IQ of
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!