1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Which of the following is a slow process that changes earth's surface?
Gekata [30.6K]

Answer:

earthquake (i think)

Explanation:

3 0
3 years ago
Read 2 more answers
How do all multicellular organisms begin? A. as complex organisms B. as a single cell C. by expanding the size of their cells D.
exis [7]
<span>B is the correct answer. Multicellular organisms, as with almost all organisms, begin life as a single cell. The increase in the number of cells can be as a result of cell division or cells combining together. </span>
4 0
2 years ago
The most complex organic compounds are the _________.
Anna [14]
Answer:  [B]:  "proteins" .
_________________________________
7 0
3 years ago
What can cause rapid revolution?
Yuki888 [10]

Answer:

Although scholarly debate continues about the exact causes of the Revolution, the following reasons are commonly adduced: (1) the bourgeoisie resented its exclusion from political power and positions of honour; (2) the peasants were acutely aware of their situation and were less and less willing to support.

Explanation:

brainliest?

7 0
2 years ago
Which organic molecules form the major structural materials of the body?
dangina [55]

Answer:

Proteins

Explanation:

They are found everywhere in the body from muscle, cell membranes, hair, enzymes, and etcetera and are responsible for the phenotype of organisms. Proteins are the ultimate expression of genes in the DNA of organisms. The DNA is transcribed by DNA polymerase into mRNA, then mRNA is translated into protein by ribosomes. This general rule is called the central dogma.

4 0
3 years ago
Other questions:
  • What does it mean to describe a scientist as sketptical?
    5·1 answer
  • Which cells transport oxygen in the blood
    10·2 answers
  • In humans, the 22 matching chromosomes are called?
    15·1 answer
  • Which of the following is not play a role in determining whether individuals get cancer from a carcinogen?
    15·1 answer
  • At which station is precipitation most likely occurring at the present time
    7·1 answer
  • Despite the high-level of biodiversity, this biome has infertile soils, principally oxisols, to which the vegetation has roots s
    6·1 answer
  • Which statements describe the pyrimidines in DNA?
    7·1 answer
  • The diagram below shows four processes, A, B, C, and D, by which carbon circulates between the atmosphere, plants, and animals.
    12·2 answers
  • Match the vitamin deficiencies and their symptoms.
    5·1 answer
  • which of the following statements most accurately reflects the mental health focus of the latter half of the 20th century? selec
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!