1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
One difference between the chromosomes of prokaryotes and those of eukaryotes is that:
vichka [17]

Answer:

c

Explanation:

hope this helps <3

7 0
2 years ago
Which treatment for a heart attack requires threading of a narrow tube or catheter through an artery to the heart? ​?
Ilya [14]
The correct answer is angioplasty.
<span>
Angioplasty is one of the treatments after heart attack including special tubing with an attached deflated balloon. The tube is threaded up to the coronary arteries. Angioplasty is usually combined with the placement of a small tube called a stent which helps to restore the flow of blood through the artery and decreases its chance of narrowing again.</span>
4 0
3 years ago
Read 2 more answers
What type of equation is this
Drupady [299]
The answer is combustion
4 0
3 years ago
What is the name of the processes that change the genetic information into each new form?
dusya [7]

I think the answer is evolution.

7 0
3 years ago
Can someone help me with my living earth homework
lesya [120]
I was debating this question for the longest time and I came up with a conclusion.



No
5 0
3 years ago
Other questions:
  • Why do letters blur when I look at a word search?
    15·1 answer
  • The electron transport chain is named for Select one: a. the removal of unnecessary electrons from the cell b. the conversion of
    6·1 answer
  • People would constantly feel the pressure of their clothes on their bodies if what process were not operating?
    13·1 answer
  • What is the vocabulary word for a section of dna that codes for a specific protein?
    11·1 answer
  • At the ends of muscles, the connective tissues merge to form a __________, which attaches the muscle to other structures.
    6·1 answer
  • Why are carbon dioxide concentrations expected to increase?
    10·1 answer
  • Indicate which drug-receptor interaction is shown at the arrow drug design
    14·1 answer
  • Villi are finger-like projections richly supplied with _____. They help in _____ in the small intestine.
    5·2 answers
  • How does energy flow through a system?
    13·1 answer
  • True or false? when describing a net force, you need to know the size and direction of the force
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!