1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Blood contains nacl, protein, and cells. the nacl is in a(n) __________, the protein is in a(n) __________, and the cells are in
andreev551 [17]
The answers are solution, colloid, and suspension respectively. 

NaCl or salt is dissolved in the blood. So this makes blood and salts a solution. You won't be able to discern the NaCl in a solution of blood and NaCl.

Proteins in the plasma make blood a colloid. Protein particles are bigger than particles in a solution but are smaller than particles in a suspension. 

Lastly, blood cells and blood make up a suspension. You would notice this characteristic in blood because red blood cells settle. 

You can observe this when your blood is drawn. When it is placed in a test tube and left alone or placed in a centrifuge. The components separate into liquid on top, where you cannot see particles like salt; plasma in the middle, which has pale yellow color and also contains proteins; and the red blood cells at the bottom that settled. 

6 0
3 years ago
Which process releases energy instead of using energy?
alukav5142 [94]

Answer:

Cells can release energy in two basic processes: cellular respiration and fermentation. Cellular respiration requires oxygen, but fermenta- tion does not. In addition, cellular respiration releases much more usable energy than does fermentation.

Explanation:

4 0
3 years ago
Read 2 more answers
A pea plant that is tall has a dominant trait. Which statements are true about the genotype/phenotype relationship of the plant?
DedPeter [7]

Answer:

B. & D.

Explanation:

3 0
4 years ago
Immunization against an influenza virus does not provide long-term protection against the disease because: *
Oliga [24]

Answer:

the virus undergoes genetic changes

3 0
3 years ago
Transcribe the following the DNA into mRNA: TGTCGAATC
Aleksandr [31]

Answer:

ACA GCU UAG

Explanation:

3 0
3 years ago
Other questions:
  • The _____ is the forensic database established by the FBI for the U.S. criminal system. CODIS NADNA ELSI GMO
    6·2 answers
  • A geologist sees this folded rock when studying in the field. He is drawn to the sample that is labeled A. He determines this fo
    10·2 answers
  • What is the atomic mass of an atom<br> with 20 electrons
    12·1 answer
  • If DEER becomes45518, what does25118 become
    15·1 answer
  • What is speciation?
    8·2 answers
  • Please help
    9·2 answers
  • ^^^In Corn snakes, for the red gene, the allele for the presence of red pigment (R) is dominant and the allele for the absence o
    8·1 answer
  • Which of the following is unseen
    14·1 answer
  • 3. Clarify why test crosses are used<br> in selective breeding.
    6·1 answer
  • (please help ASAP!) Chimpanzees, chickens, cows, and human beings all share a gene for an insulin hormone. What does this sugges
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!