1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Which cytokine is involved in producing cachexia syndrome?
elixir [45]

Cachexia is associated with higher-than-normal concentrations of tumor necrosis factor α (TNF-α), interleukin (IL) 1, IL-6, serotonin


8 0
3 years ago
Which of the following statements is true?
Dennis_Churaev [7]

That would be. All of the above.

5 0
3 years ago
Read 2 more answers
What are the possible anticodons in the tRNA molecules that carry serine to the ribosome?
Brilliant_brown [7]
The possible tRNA for serine are UCU, UCC, UCA, UCG
3 0
3 years ago
The respiratory zone is the only site of gas exchange within the lungs. the respiratory zone is the only site of gas exchange wi
34kurt
I think its false because gas exchange can happen in blood also 
4 0
3 years ago
Which reading is expected from a thermometer near Earth’s surface during a period of freezing rain? 10°C? 32°C? 37°F? 32°F?
jek_recluse [69]
The freezing temperature of rain (water) on Earth at sea level in Fahrenheit is 32 F. In Celsius water freezes at 0 C.
5 0
4 years ago
Read 2 more answers
Other questions:
  • Answers are
    8·1 answer
  • Which molecule is active first during dna replication?
    8·2 answers
  • The different forms of a gene for a given trait are called_____<br><br> A. alleles<br> B. plants
    8·2 answers
  • Some species of millipedes will roll into a ball when threatened, while other species of millipedes can secrete noxious chemical
    9·2 answers
  • Your friend's mother was always baking ginger-flavored cookies whenever you were at their house. You loved those cookies, and wo
    6·2 answers
  • Can someone please help me with this problem
    8·2 answers
  • Por qué en algunos países es de día mientras que en otros es de noche?
    5·1 answer
  • Which choice describes the thyroid?
    9·1 answer
  • AG CLASS HELP!!!!!!
    5·1 answer
  • My little sister asked me how babies were made bc my parents wont tell her im wondering how i should tell her. Any ideas?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!