1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
ANSWER FIRST GET BRAINLY
Tasya [4]

Answer: Blood plays a very important role before cellular respiration. The blood provides oxygenated blood for the aerobic processes that takes place during cellular respiration. Glycolysis, link reaction, Kreb's Cycle and Electron Transport Chain are all the aerobic process of Cellular respiration that requires oxygen. Without blood aerobic cellular respiration cannot occur as the source of oxygen is blood. The blood provides oxygen before cellular respiration. After cellular respiration the waste materials are carried away by blood only.

Hence, blood plays an important role before cellular respiration.

7 0
3 years ago
Read 2 more answers
What three letter codon will produce Tryptophan?
Taya2010 [7]

Answer:

UGG

Explanation:

Look at a codon chart then look for Tryptophan then look for the 3 letter codon that corresponds

3 0
2 years ago
Which symptom is unique to amyotrophic lateral sclerosis (als) and is not observed in multiple sclerosis (ms)?
Nonamiya [84]

ALS is a rapidly progressive and fatal neuromuscular disease. MS is a scarring and hardening of the sheath around the nerves in the brain, spinal cord, and optic nerve. MD is a muscular disorder with specific kinds of MD involving different muscles in the body. MD is almost exclusively hereditary

<h3>What is Amyotrophic lateral sclerosis (als) ?</h3>

The motor neurons steadily degrade and eventually die as a result of ALS. The brain, spinal cord, and all the muscles in the body are connected by motor neurons. When motor neurons are destroyed, they stop communicating with the muscles, which prevents the muscles from working.

  • Five to ten percent of all ALS cases are familial, meaning the patient gets the illness from a parent. Typically, only one parent needs to have the disease-causing gene to have familial ALS.

Learn more about Amyotrophic lateral sclerosis here:

brainly.com/question/14863487

#SPJ4

4 0
1 year ago
The human respiratory syncytial virus nonstructural protein 1 regulates type i and type ii interferon pathways
RoseWind [281]
I am not sure but here is a link to help you :)

https://www.ncbi.nlm.nih.gov/pubmed/22322095
6 0
3 years ago
Which of the following is a subatomic particle located inside the nucleus of
gtnhenbr [62]

The answer is :

B. Neutron

8 0
3 years ago
Other questions:
  • The most nutrient-poor soils are found in _____ biomes.
    9·2 answers
  • How does the structure of DNA differ from the structure of RNA?
    10·2 answers
  • Dehydration synthesis is a process in which
    13·1 answer
  • What part of the nervous system is very well protected by bone? (1 point)
    12·1 answer
  • Do you believe that climate change is real?
    7·1 answer
  • During which process is oxygen gas released into the atmosphere?
    10·1 answer
  • Why did Robert Hooke choose the name of the tiny chambers that he saw in his microscope?
    10·2 answers
  • Fax about blue eyes i don't mind two BRAINLES​
    15·2 answers
  • What type of biomolecule is lactose
    15·2 answers
  • A Giant factory farm uses large open lagoons to treat waste from the buildings where hogs are stored. The problem is that the la
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!