List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
1 answer:
You might be interested in
When an area is malaria-free, the HbS allele frequency is between 0 and 2.02. Thus, option "A" is correct.
<h3>How, explain your answer briefly?</h3>In the two maps that show the allele frequency of sickle haemoglobin (HbS) and malaria endemicity in Africa, it can be seen that in the regions with no malarial outbreak or malaria-free areas coincide with the grey to lighter shades of red in the heat map of the allele frequency of HbS. The colour coding in the heat map for the allele frequency tells us that the frequencies range from 0 to 2.02 in the malaria-free areas.
Hence the answer is A)When an area is malaria-free, the HbS allele frequency is between 0 and 2.02.
To learn more about click here:
#SPJ1
