1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Just curious: do flies have kidneys?
viktelen [127]

Answer:

No but they have cardiac chamber, compared with humans' four-chamber hearts, are a group of cells called nephrocytes that serve the same function as human kidneys

Explanation:

3 0
3 years ago
Read 2 more answers
Centrioles are found in animal cells t or f
vekshin1
True, centrioles can be found in animal cells
6 0
4 years ago
A rabbit population's birth rate is 200 rabbits born/year. The death rate is 150 rabbits dying/year.
Tpy6a [65]

Answer:

It's growing

Explanation:

The growth rate is 50 rabbits per year

8 0
3 years ago
Paul ekman and walter friesen traveled to new guinea to study the meaning of various facial expressions in the primitive south f
konstantin123 [22]

The conclusion they reached was that the six major emotional expressions appear to be universal.

<h3>What are facial expressions?</h3>

Facial expressions are the various movement of the face that shows the emotional state of an individual.

The six major emotional expressions are :

  • anger,

  • happiness,

  • fear,

  • surprise,

  • disgust and sadness.

These are be expressed by any individual in any part of the world.

Therefore, the conclusion they reached was that the six major emotional expressions appear to be universal.

Learn more about emotion here:

brainly.com/question/4692301

#SPJ1

4 0
2 years ago
Mistakes can happen during DNA replication, and if they are not repaired it can result in a mutation. Certain mutations can lead
polet [3.4K]
Mutations result either from errors in DNA replication or from the damaging effects of mutagens, such as chemicals and radiation, which react with DNA and change the structures of individual nucleotides. All cells possess DNA-repair enzymes that attempt to minimize the number of mutations that occur
8 0
2 years ago
Other questions:
  • A hydrocarbon has molecular formula C3H8. Identify the class of hydrocarbons it belongs to.
    7·1 answer
  • BIOLOGY! PLEASE HELP. WILL GIVE YOU BRAINLIEST
    14·1 answer
  • If you are looking at an object that measures 0.5 mm and the image you see is 10 mm long. Your friend is looking at an object th
    13·1 answer
  • What age will people start muturing?
    12·1 answer
  • PLEASE HELP!! Gas cloud 1 is likely to form a star. Gas cloud 2 is not. Based on this information, match the given conditions wi
    10·1 answer
  • 11. What did Darwin think about on his journey home to England?
    10·1 answer
  • What was the result of using drainage blocks to keep water in the field level during the growing season?
    9·1 answer
  • A researcher found a beautiful plant while traveling in Alaska and collected its seeds. When she came back to Florida, she soake
    15·1 answer
  • Answer the questions below. Will mark the correct answer as brainliest and report irrelevant answers.
    7·1 answer
  • Where does most life on earth get its energy?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!