1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Why are certain amino acids called essential amino acids?
Marta_Voda [28]
Essential amino acids refer to the eight amino acids the adult body needs, which they cannot be synthesized correctly or at all.
The essential amino acids must be obtained from food such as proteins (meats, seafood, milk, eggs, etc).
7 0
3 years ago
Read 2 more answers
Complementary DNA? please help​
topjm [15]

Answer: From top to bottom- T, C, G, A, T, A, T

Explanation:

These are the nitrogenous bases that make up a part of nucleotides in DNA.

There are 4 bases in DNA:

- Adenine

- Guanine

- Thymine

- Cytosine

The bases pair together from A to T and G to C, the way I remember is just reading it as AT GC and it works for me, but you make want to make an acronym if it helps you remember better.

As a result, all you have to do is type in the corresponding base to form the correct base pairs.

3 0
2 years ago
Evolution is all of the following
frosja888 [35]

♛┈⛧┈┈•༶༶•┈┈⛧┈♛♛┈⛧┈┈•༶༶•┈┈⛧┈♛

3 0
2 years ago
What are to two types of gametes?A gamete is also known as?
STALIN [3.7K]

Answer:

What are to two types of gametes?

Sperm and Egg

A gamete is also known as?

Sex cells

What is the process called when the fusion of gametes create a zygote?

Fertilization

Is a zygote a diploid of haploid cells?

Diploid

<u>-TheUnknownScientist</u>

5 0
3 years ago
Read 2 more answers
What is the plural of furniture​
Aleonysh [2.5K]

Answer:

Furniture or furnitures

Explanation:

7 0
3 years ago
Other questions:
  • I have two questions; if you can answer both that’s great, but if you can only answer one, that is fine too.
    12·2 answers
  • Which is not an age-related change that alters the integument? which is not an age-related change that alters the integument? re
    11·1 answer
  • The nurse is assessing a 10-month-old infant during a checkup. which developmental milestones would the nurse expect the infant
    8·1 answer
  • How do you find a genotype and a phenotype.
    15·2 answers
  • How do hormones move around the body
    7·2 answers
  • Which of the following elements is required for growth and development and is in our DNA? *
    15·1 answer
  • A teacher says she has identified an organism with these characteristics: eukaryotic, multicellular, autotrophic, and a cell wal
    15·1 answer
  • Why is sandstone classified as a nonrenewable resource?
    9·2 answers
  • Which substance on the plasma membrane helps identify chemical signals from outside the cell?
    11·1 answer
  • Male cones grow near the of the plant while female cones are located near the
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!