1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Biology
1 answer:
Pavel [41]3 years ago
7 0
AAGAUGGGAUGUAUCUGAGUA
You might be interested in
Bones kept in hydrochloric acid becomes soft why?
DanielleElmas [232]

Bones are made up of Calcium Phosphate given by the chemical formula, Ca_{3}(PO_4)_2. When bones are kept in Hydrochloric acid, given by the chemical formula, HCl, they become soft because the calcium compound present in the bones changes its form. The following double displacement reaction takes place when the bones are kept in HCl,

Ca_{3}(PO_{4})_{2} + HCl ---> CaCl_{2} + H_{3}PO_{4}

Calcium chloride is water soluble, and gets washed away. This makes the bone thin and soft.

7 0
3 years ago
If the frequency of a dominant allele in a population in equilibrium is 0.35, then the frequency of the corresponding recessive
Nadusha1986 [10]

Answer:0.8775

Explanation:formula for gene frequency is p+q=1

where p is the dominant allele and q is the recess allele.

Given than p=0.35

P^2=0.35^2=0.1225

q=1-p

q=1-0.1225=0.8775

Answer is 0.8775

3 0
3 years ago
What other component does nuclear power utilize in order to
Oliga [24]

Answer:

Explanation: The answer would be water because , nuclear power plant would heat the water so that it could produce steam .

7 0
2 years ago
A rock can be highly permeable but also non-porous. <br> True <br> False
vekshin1
<h3><u>Answer;</u></h3>

The above statement is <u>false</u>

<h3><u>Explanation</u>;</h3>
  • Rocks have different porosity and permeability characteristics, which means that water does not move around the same way in all rocks below ground.
  • Permeability greater than 250 mD are considered very good, while permeability less than 1 mD are considered poor.
  • Low porosity normally results in low permeability, but high porosity does not necessarily imply high permeability. It is possible to have a highly porous rock with little or no interconnections between pores.
8 0
3 years ago
7.
yulyashka [42]

Answer:

27.5

Explanation:

Divide 75 by 6. You get 12.5. Multiply 12.5 by 2.2 (when converting kilo to pound, you multiply by 2.2) Then, you'll get 27.5. The answer is 27.5 pounds/lbs.

6 0
3 years ago
Other questions:
  • The absence of ________ leaves obligate anaerobes susceptible to killing by oxygen.
    13·1 answer
  • In typical relationships, one would expect the most bickering between _____.
    13·1 answer
  • Which important biomedical process recieves a supply of NAD+ ions from the fermentation process during anaerobic respiration
    14·1 answer
  • What is the difference between covalent and iconic bonding's
    6·2 answers
  • What ways can ions enter the ocean
    14·2 answers
  • Who was the father of socilism​
    8·2 answers
  • Explain how genetic modifications impact crop yield. How will this help feed the world in 2050?
    14·1 answer
  • A ____________ (redox/synthesis) reaction is a reaction between at least two compounds in which a new, more complex compound is
    7·1 answer
  • Biology is considered the study of life.<br> True<br> False
    6·1 answer
  • Please help me please please
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!