1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
3 years ago
14

Which of the following terms applies to hydrogen sulfide

Biology
1 answer:
Ivahew [28]3 years ago
8 0

Hydrogen Sulfide (H2S) Hydrogen sulfide is a colorless, flammable, extremely hazardous gas with a “rotten egg” smell. It occurs naturally in crude petroleum and natural gas, and can be produced by the breakdown of organic matter and human/ animal wastes (e.g., sewage).



so a

You might be interested in
Why Aids can not be treated?
pogonyaev

Answer:

The virus integrates into long-lived immune system cells and remains dormant in those cells for many years.HIV's ability to hide its instructions inside of cells where drugs cannot reach it.

8 0
3 years ago
How is a frog disected?
Stella [2.4K]
<span>Lay the frog on its back, spread out its limbs, and pin them to the tray. Use forceps to lift the skin between the hind legs and make a small incision with a scalpel. Continue the cut up the center of the frog's body with scissors, being careful to cut through the skin only. Use forceps to hold the skin away from the muscle while you cut, if necessary. Make horizontal incisions just above the legs and just below the arms, then fold the resulting flaps back and pin them. (You may need to use a scalpel to help separate the skin from the muscle underneath as you fold it back.)Repeat the incisions as before, this time cutting through the muscle layer to a point just below the arms. Lift the muscle with the forceps to prevent cutting the organs underneath.When you reach the area just below the arms, turn your scissors and make horizontal cuts through the hard sternum. Repeat the horizontal cuts just above the arms, and then remove the bony strips entirely. Pin the remaining muscle flaps back, just as with the skin.<span>Look into the body cavity. The yellow finger-like projections on the sides are the fat bodies. It may be necessary to remove some of these in order to see the organs clearly. Likewise, a female specimen may have well-developed eggs filling the body cavity and obscuring the organs. Remove them as necessary.</span></span>
4 0
3 years ago
HELP PLS! I WILL GIVE BRAINLIEST!! :))
garri49 [273]

Answer:

Nature

Explanation:

Because erosion happens in the nature.

8 0
3 years ago
Read 2 more answers
20 POINTS!! please help! I can't understand this!!!
xz_007 [3.2K]

The ground finches adapted to have larger beaks to eat the bigger seeds in the drier seasons. This means over the years only the bigger beaked finches could survive to reproduce.

3 0
3 years ago
Pls help i dont understand :( Will Give Brainliest + 25 points!!
Airida [17]

Answer:

Transformed into chemical energy

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which organelle is responsible for energy production in the cell?
    15·1 answer
  • True or False? Kidney beans are considered to be a complete or high quality protein.
    11·1 answer
  • Why are fences put along some beaches ?
    14·2 answers
  • Energy can exist in many different forms, including those you can detect in a burning fire or in a lit lightbulb. Which of these
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What provides clues about the ocean and climate including the type of marine life presented?
    5·2 answers
  • If the sequence of bases on the mrna codon is auu what would be the sequence of bases on the trna anticodon
    14·1 answer
  • Identify different carbon pools.
    8·2 answers
  • how does an electron transport chain lead to the generation of atp in the light-dependent reactions of photosynthesis?
    11·1 answer
  • Genetics and inheritance are controlled by the laws of _________. Each parent has ________ alleles for each trait. You have a __
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!