1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
3 years ago
5

What type of molecules will create a solution when mixed with water

Biology
2 answers:
blondinia [14]3 years ago
8 0

Answer:

Polar and soluble molecules.

Explanation:

The water is a polar molecule and consists of partial positive and partial negative charge. The water is known as universal solvent as it can dissolves most of the solutes.

The polar molecules can easily dissolve in water. Like dissolves like or polar molecule can dissolve in polar solvents. The soluble molecules that are polar and has similar characteristics like water can easily dissolve in water.

Thus, the answer is polar molecules.

marta [7]3 years ago
7 0

Answer:

soluble molecules

Explanation:

Soluble molecules dissolve completely when mixed with water, hence forming a solution

You might be interested in
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
Fish fossils have been found in some places where there is no longer any water. Sometimes, they are found on tops of mountains.
Ksivusya [100]

Answer:

B. These Places were once underwater.

Explanation:

The best explanation to the information given is B.

Other options cannot be considered since there are no scientific background for fishes living on land nor fossils causing water evaporation neither fish that climbing mountain.

4 0
3 years ago
The typical growth period of a cell occurs during which stage of the cell cycle?
aliya0001 [1]

Answer:

Interphase

Explanation:

interphase is composed of G1 phase (cell growth)

8 0
3 years ago
An insertion occurs during dna replication, causing an additional guanine to be inserted into the nucleotide strand after the gu
Evgesh-ka [11]
This could lead to an altering of the proteins tertiary structure which could make the protein non functioning (if cytosine didn’t attach to it) or give it a different function.
4 0
4 years ago
What is the main function of the endocrine system?
Romashka [77]

Answer:

c

Explanation:

to secrete hormones.this let the harmones travel to cells in other parts of body.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Select the correct answer from each drop-down menu. Temperate grasslands and (blank) are two biomes that are dominated by grass
    9·1 answer
  • What is the transcription of DNA: T A C C G C T C C A G G G T C G A C A A T A C C C T A A T T?
    11·2 answers
  • State two reasons why the large ground finch and sharp-billed ground finch could live on the same island but not compete for foo
    13·2 answers
  • ________ allow materials to be exchanged between the blood and tissues, ________ carry blood towards the heart, and ________ car
    11·1 answer
  • the diagram shows the process in which pre-mRNA is changed into mrna; select and place the two appropriate labels for the diagra
    8·1 answer
  • In one of the first steps in Prophase I of meiosis,
    15·1 answer
  • Help pls i need this right now
    10·1 answer
  • Polar molecules tend to be
    5·1 answer
  • Which of the folloing are testable scientific questions. Check all that apply.
    11·1 answer
  • What are the final stages of cirrhosis of the liver
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!