effect is from the modification of land surfaces. Waste heat generated by energy usage is a secondary contributor.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
The answer is <span>c. mutualism.
</span>
<span>Mutualism is a relationship between two
different species in which both species have benefits. In this example, ants benefit because they feed on aphids' wastes while aphids benefit because ants provide them protection.
</span>
<span>Commensalism is a relationship between two
species in which only one of them has benefit, and the other one is not
affected. Parasitism is a relationship between two species in which only
one of them has benefit, and the other one is harmed.</span><span>
</span>
