1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Genrish500 [490]
4 years ago
15

What is produced by the lymph system?

Biology
2 answers:
skad [1K]4 years ago
8 0

Answer:

yes its white blood cells

Explanation:

gulaghasi [49]4 years ago
7 0

Answer:

the answer is the white blood caells.

You might be interested in
Amino acids are the building blocks of, fats, proteins, carbohydrates, or nucleic acids.
Darina [25.2K]

I believe it’s proteins

3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
a person with AIDS is more likely to catch a disease that healthy people usually dont catch. what is the term for those infectio
Ilia_Sergeevich [38]
I think it might be the first one: hiv infections. (hope this helps!)
5 0
3 years ago
Read 2 more answers
What is true about genetic mutations?
Nat2105 [25]
C) Most are negative
8 0
4 years ago
24. Fill in the blanks. An enzyme is made up of _____. Enzymes can
Nikitich [7]
Enzymes are made of strings of amino acids chemically bonded to one another. These bonds give each enzyme a unique structure, which determines its function. They mostly break down carbohydrates and fats. Once a protein source reaches your stomach, hydrochloric acid and enzymes called proteases break it down into smaller chains of amino acids. Amino acids are joined together by peptides, which are broken by proteases.
6 0
3 years ago
Other questions:
  • 5. Suppose that a dominant allele (P) codes for a polka-dot tail and a recessive allele (p) codes for a solid colored tail. In a
    9·1 answer
  • Researching the Circulatory System also called the Cardiovascular System.
    12·1 answer
  • Male-female structural differences in the brain are referred to as _______.
    12·1 answer
  • Match the following items
    15·1 answer
  • Describe the function of three areas of the brain (you choose which areas).
    10·1 answer
  • Which of the following statements is true of nuclear fusion?
    15·2 answers
  • Can all energy be recycled?
    15·1 answer
  • Which is a component of cell theory?
    11·2 answers
  • Groups of specilized cells working together are called
    11·1 answer
  • What makes stem cells so important in medical research
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!