1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brut [27]
3 years ago
7

Biology Assignment

Biology
2 answers:
Over [174]3 years ago
5 0

Answer:

The purpose of fungi and algae is to decompose dead plants and animals to break them down into smaller molecules that can be used by other members of the ecosystem

Explanation:

Katen [24]3 years ago
3 0

Answer: for number 1 : ➡Some unicellular fungi are used in production of bread and beer➡Fungi associated with the root of higher plants as mycorrhizae are used in agriculture. Economic Importance of Algae : ➡Algae are primary producers for all aquatic animals in food cycle

for number 2: Algae regenerate by sexual reproduction, involving male and female gametes (sex cells), by asexual reproduction, or by both ways. ... Many small algae reproduce asexually by ordinary cell division or by fragmentation, whereas larger algae reproduce by spores.

You might be interested in
If a drug is classified as being cytostatic the action of the drug would be
hichkok12 [17]
To inhibit cell division, such as those meant to treat cancer. 
3 0
3 years ago
Cual es el proceso molecular de las neuronas?
Rasek [7]

Answer:

un tipo de célula altamente especializada cuya principal característica es su incapacidad para reproducirse. Esto significa que el ser humano nace con una cantidad determinada de neuronas, las que, si bien no pueden duplicarse, han demostrado ser unidades muy plásticas y capaces de generar reacciones en situaciones bastante desfavorables.

Explanation:

5 0
2 years ago
What must happen for the pupil of the eye to dilate?
Ad libitum [116K]
Stimulation of the sympathetic nervous system is required
4 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
In three to five sentences, explain the advantage of keeping some DNA needed by mitochondria in the cell’s nucleus and some in t
PolarNik [594]

Answer: Keeping those genes locally in the mitochondria gives the cell a way to individually control mitochondria,” Johnston says, because pivotal proteins are created in the mitochondria themselves. ... Other structures in our cells could also benefit from this type of local control.

6 0
2 years ago
Other questions:
  • A student creates a model of a closed ecosystem by filling a glass tank half full with water then addin 10 snails and two small
    11·1 answer
  • What are three kinds of bonds that carbon atoms can form?
    12·1 answer
  • A scientist noticed that a dark-colored peppered moth is more visible on a light-colored background than a light-colored peppere
    7·2 answers
  • If all the grass disappeared from this community, which
    14·2 answers
  • What is a good definition for a sex linked disorder ?
    7·2 answers
  • What type of association would you expect between a person's age and hair length?
    14·1 answer
  • Please help!!! I don't understand the questionnn
    12·2 answers
  • Which pair of scientists put their ideas together to create the initial Cell Theory?
    11·1 answer
  • Need Answer ASAP. Why do disruptive selection pressures tend to favor rapid evolutionary changes?
    6·1 answer
  • What differences between physical and chemical barriers​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!