1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BaLLatris [955]
3 years ago
9

Many scientists suggest that billions of years ago,

Biology
1 answer:
Maru [420]3 years ago
7 0
I think your anwser would be all of the above but you don't have it

You might be interested in
A 60 year-old man has long managed his type 1 diabetes effectively with a combination of vigilant blood sugar monitoring, subcut
ivanzaharov [21]

The question is incomplete as it lacks the multiple options. The multiple option are as follows;

Careful monitoring for level of consciousness and resolution of hypoglycemia .

IV infusion of 50% dextrose and water solution .

Administration of subcutaneous glucagon

Administration of 15 to 20 g of glucose in a concentrated carbohydrate source

Answer:

Administration of 15 to 20 g of glucose in a concentrated carbohydrate source.

Explanation:

The insulin and glucagon hormone maintains the blood glucose level in the humans. In case of Type I diabetes a little amount or no amount of insulin is made by the pancreas.

The wife of a man has caused insulin error that creates hypoglycemic condition means the individual has low blood glucose level. The intake of carbohydrates can increase his blood glucose level. The wife should give 15 to 20 g of glucose to make the conditions normal.

Thus, the answer is option (4).

7 0
3 years ago
O q u e s ã o t e n d õ e s ?
Setler [38]
What are the answer choices?
7 0
3 years ago
How are photosynthesis and respiration related to each other?
Pavel [41]
The answer is B.
It describes the relationship between photosynthesis and respiration accurately.
3 0
2 years ago
A molecule of a complex carbohydrate is made of 12 carbon atoms. Calculate the numbers of hydrogen and oxygen atoms in the molec
kykrilka [37]
The answer would be 12 oxygen and 24 hydrogen
since the basic formula of carbohydrates is C6H12O6
6 0
3 years ago
What are the two main types of cells and where are they found in the human body?
irga5000 [103]

Answer:

They are prokaryotes and eukaryotes and prokaryotes are single celled and eukaryotes are multi celled

Explanation:

Hope that helps! Have a fantastic day!

7 0
3 years ago
Other questions:
  • During prophase, each pair of chromosomes is attached to each other by the _____. chromatin chromatid centromere DNA
    7·2 answers
  • Chapter 14 Case Study: Genetic dwarfism Seven months pregnant, an expectant mother was under-going a routine ultrasound. While p
    12·1 answer
  • Glucose —> lactic acid —> carbon dioxide and water
    10·1 answer
  • Joanne’s puppy is very large, but also submissive. when the puppy meets a more dominant dog, she lies on the grass on her back,
    11·2 answers
  • Why are there species instead of a continuum of various animals?
    8·1 answer
  • A study has shown that Scotland's river otter population is increasing after falling
    6·1 answer
  • HELP please I’ll make the correct answer the brainliest
    14·1 answer
  • How is Cytochrome C, which is an important enzyme in cellular respiration, used to provide evidence for evolution
    6·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which of the following best describes the significance of the sequence of an individual’s DNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!