1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nezavi [6.7K]
3 years ago
14

BRAINLIESTTT ASAP!!!

Biology
2 answers:
anzhelika [568]3 years ago
8 0

Answer:

Food: Cheese

Medicine: Penicillin

Explanation:

Fungi refer to a type of organisms that obtain their food from plant or animal materials. Fungi are used to make:

-Cheese: There are some types of cheese like blue cheeses in which the Penicillium fungi provide the blue veins. Also, Camembert cheese that has fungal webs and Penicillium camemberti is used.

-Penicillin: This is an antibiotic that comes from Penicillium fungi and it is used to treat bacterial infections.

Reil [10]3 years ago
4 0

1. penicillin 2. lovastatin

Hope this helps don't forget to hit that heart :)

You might be interested in
What are characteristics of a plant?
astra-53 [7]

Plant Characteristics. Plants are autotrophs; they produce their own food. They do so via photosynthesis, which is the process of making nutrients such as sugars from light energy and carbon dioxide.

Please mark as brainliest

5 0
3 years ago
1. Fossils are the _____
Ksivusya [100]
Fos·sil<span>ˈfäsəl/</span>nounthe remains or impression of a prehistoric organism preserved in petrified form or as a mold or cast in rock. 
 so B

6 0
3 years ago
Read 2 more answers
Density is mass divided by volume (d = m+ y). Based on the graph, what happens to a fixed mass of water when it is cooled from 4
djverab [1.8K]

Answer:

no freaking clue buddy that looks made up

Explanation:

ion know

3 0
3 years ago
We get wood from trees. Tree - wood - ________. What word BEST fills in the blank and describes what makes up wood? A) atoms B)
NeX [460]
B because it’s talking about the tree itself. Saying that it’s plants would divert it to a different plant. The cells of the wood is what makes the tree and is relevant to the question
4 0
3 years ago
Read 2 more answers
Why should a community use sustainable practices to produce food?
9966 [12]
The answer to this question is :B
3 0
2 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the difference between Biogenous and Lithogenous?
    13·1 answer
  • Describe the advantages and disadvantages of a command economy
    9·1 answer
  • Which of the following is an environment hazard created by humans
    8·1 answer
  • A cell develops into a specific cell type during development; that is, it starts to differ in structure and function from other
    6·1 answer
  • In which type of blood vessel is the velocity (rate of blood flow fastest?
    5·2 answers
  • (GIVING BRAINLIEST AND THE REST OF MY POINTS!!!!!!!)
    10·1 answer
  • The relationship between the remora and the shark is an example of - (5.5)
    9·2 answers
  • Did I bleed through my pants
    14·1 answer
  • Birds migrating, cats chasing prey, sea turtles moving toward the ocean immediately after birth, and a joey (baby kangaroo) movi
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!