1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
7

There is a risk that __________ can be transferred when using stem cells in medical treatments. What word completes the sentence

?
Biology
1 answer:
Rina8888 [55]3 years ago
5 0

Answer:

Bone marrow transplantation

Explanation:

Stem cells are special cells generated in bone marrow. This can changed into different types of cells. They are  red blood cells It carries oxygen to the body cells .White blood cells Resisting agents from infections . Platelets it performs clotting of blood

Stem cell transplant involves in removing of damaged cells instead placed stem places from blood or bone marrow

You might be interested in
Describe an additional laboratory test that could be used to confirm the diagnosis of one of the patients who is not infected wi
Llana [10]

Meninges refers to the three layes of membranes surrounding the brain and spinal cord of the mammals. The inflammation of these protective membranes of the brain and the spinal cord caused by the infection of bacteria, virus or other microorganisms is called the meningitis.

A laboratory test to identify or rule out meningitis is the analysis if the cerebrospinal fluid (CSF) by lumbar puncture. CSF is a colorless fluid filling the ventricles of the brain and the central canal of the spinal cord. Lumbar puncture is a techinque of isolating the CSF from the sac sround the spinal cord using a needle under a local anesthetic. The sample is then analysed for the opening pressure which is normally between 6 and 18 cm of water in a patient who is not infected with meningitis. Also, the levels of glucose in CSF is above 40% of that in blood in non-infected persons. If lactate levels are less than 35mg/dl, this will also rule out meningitis.

8 0
3 years ago
GIVING BRAINLIEST TO FIRST GOOD ANSWER
Rasek [7]
Well it’s including sweat and for sweat to get sticky it has to be high heat so I’m going with

C
3 0
2 years ago
GenAlex Medical, a leading manufacturer of medical laboratory equipment, is designing a new automated system that can detect bor
SashulF [63]

Answer:

The minimum mass of dissolved cholesterol that the new system must be able to detect is 0.43 milligrams.

Note: The question is incomplete. The complete question is:

<em>GenAlex Medical, a leading manufacturer of medical laboratory equipment, is designing a new automated system that can detect borderline high levels of dissolved cholesterol (170, to 200. mg/dL), using a blood sample that is as small as 250 μL Calculate the minimum mass in milligrams of cholesterol that the new system must be able to detect Be sure your answer has the correct number of significant digits.</em>

Explanation:

Range of the equipment to detect cholesterol in blood = 170.0  to 200.0 mg/dL

Minimum amount of cholesterol that can be detected by instrument = 170 mg/dL

Volume of blood sample = 250 <em>μ</em>L= 0.0025 dL (1 dL = 100000 <em>μL)</em>

Amount of dissolved cholesterol in 250 <em>μL</em> sample of blood =

170 mg/dL * 0.0025 dL =  0.425 mg

The minimum mass of cholesterol that the new system must be able to detect is 0.43 milligrams.

7 0
3 years ago
Black truffles are a unique type of fungi that are highly prized by chefs and food enthusiasts throughout the world. Which chara
Katen [24]

Answer:

Has spores contained in ascus

Explanation:

That's the main difference between mushrooms and truffles.

8 0
2 years ago
6 steps of translation in order biology
densk [106]

Answer:

step 1: mRNA attaches to the ribosome

step 2: tRNA's attach to free amino acids in the cytoplasmic "pool" of amino acids

step 3: tRNA carries its specific amino acid to the ribosome

step 4: tRNA "delivers" its amino acid based on complementary pairing of a triplet code (anticodon) with the triplet code (codon) of the mRNA

step 5: Enzyme "hooks" the amino acid to the last one in the chain forming a peptide bond

step 6: Protein chain continues to grow as each tRNA brings in its amino acid and adds it to the chain

5 0
2 years ago
Other questions:
  • The ____________ urethra is a short segment that passes through a reproductive organ. it receives secretions from two ejaculator
    14·2 answers
  • 1. Schizophrenia_______.
    11·2 answers
  • The term srimulus comes from the latin word stimulare, which means "to goad, prod, or urge." Explain how this meaning relates to
    5·1 answer
  • Direct gene activation involves a second-messenger system. True or False
    9·2 answers
  • At which hotspot would you view Polaris at an altitude of 45°?
    14·1 answer
  • What ultimatum did austria deliver to serbia?
    7·2 answers
  • Pigment found in plants are necessary for​
    12·2 answers
  • When a species adapt to its environment is this an example of natural selection or evolution
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which of the following words or phrases acts as a signal for chronological sequence?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!