1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
13

Which is the correct way to write the scientific name of a guru it fly

Biology
1 answer:
babunello [35]3 years ago
7 0
Are you talking about a fruit fly?

You might be interested in
A mutation can cause a defect in human hemoglobin. Which would result in this type of mutation?
GrogVix [38]
Sickle-cell disease can result. 
Hope this helped you.
6 0
2 years ago
Read 2 more answers
Which vessel takes oxygenated blood from the left ventricle to the rest of the body?
eduard

Answer:

Aorta

Explanation:

7 0
3 years ago
Plants take in the sun's energy by absorbing Select one: a. high-energy sugars. b. chlorophyll a. c. chlorophyll b. d. sunlight.
Sidana [21]

Answer:

the answer is D

Explanation:

the molecules of chlorophyll absorb the sun's energy in form if light

8 0
3 years ago
Why is there so much variety of bacteria in the mouth
Alex
Hello

It is because ur mouth is a dark and warm place which is the perfect environment for bacteria to grow and survive. It doesn’t matter if u brush it really well on ur tounge there and groves in ur tounge where the toothbrush bristles cannot reach and clean so that is where the bacteria lives.

Hope this helps
Plz mark me as Brainliest
3 0
2 years ago
Read 2 more answers
How many plant and animal species do wildlife experts estimate are endangered?
Burka [1]

The right answer is c. 3 to 10 million

The latest estimates are a bit more precise: there are 8.7 million living species (which is included in the range between 3 and 10 million), 6.5 million on land and 2.2 million in the water. Which is amazing, since there is more sea than land on our planet.

Researchers estimate that there are 7.77 million animal species, only 298,000 plant species and 611,000 species of fungi and molds.

8 0
3 years ago
Read 2 more answers
Other questions:
  • A fully functioning enzyme molecule is arranged in a complex three-dimensional shape. this shape determines the
    6·2 answers
  • Once the sun exhausts its fuel and burns itself out, it cannot be replaced. So why is the energy from the sun considered a renew
    15·1 answer
  • HELP ASAP PLEASE!!
    13·2 answers
  • What are four sources of minerals?
    11·2 answers
  • Is an avocado a complex fruit
    10·1 answer
  • an animal cell on the left and plant cell on the right which two cell parts are most likely found in both types of cells
    9·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why is it a good idea to substitute transitions for visual elements in a text?
    5·2 answers
  • Taxomony
    6·2 answers
  • FUN QUESTION maybe challenging I'm sort stuck i can't figure out!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!