1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alborosie
3 years ago
6

A.What patterns do you notice in how the airborne pathogen spreads

Biology
1 answer:
RSB [31]3 years ago
6 0
Answer:
             Air born pathogens are minute creatures responsible for causing a variety of illness. These pathogens may be bacteria, virus or fungi and spread through a variety of mechanism. When an infected person sneeze, respiratory droplets add into air. These infectious droplets when inhaled by a healthy person he become ill.Example is flue virus.
 

You might be interested in
The major forces that form folded mountains are
defon
It would be at a convergent plate boundary
5 0
3 years ago
Read 2 more answers
A biology teacher gives each pair of students in her class a group of 30 newly sprouted bean plants. She tells the class to desi
pychu [463]

Answer: I think It's D

7 0
3 years ago
Read 2 more answers
Dark skin ( a result of increased melanin production in equatorial populations), is likely a response to ultraviolet radiation b
AlladinOne [14]

Answer: Skin cancer

Explanation:

Melanin is a pigment derived from an amino called acid tyrosine. The most common form of melanin is called eumelanin, which is a polymer of dihydroxyindole carboxylic acids and their reduced forms.<u> When a person is exposed to the ultraviolet light (UV) from the sun, the melanocytes will produce eumelanin to prevent the skin from burning and damage to the cell nuclei (where DNA is found)</u> of the epidermis. This melanin production causes the skin to darken. The eumelanin in the skin then acts as a natural sunscreen by blocking the damaging effects of sunlight. So, skin darkens when exposed UV light, thus providing greater protection when needed by producing more eumelanin, but it also becomes more likely to develop melanoma, which is a type of skin cancer. This is because UV rays damage the DNA of skin cells. <u>The DNA (deoxyribonucleic acid) is the genetic material that has the instructios to the growth and functioning</u> of an organisms). Skin cancers begin when eumelanin protection is not sufficient and this damage affects the DNA of the genes that control the growth of skin cells. <u>This results in a tumor, which is the uncontrolled growth of cells </u>(in this case, skin cells) because there will be a mutation in DNA that affects the function of the cells.

8 0
3 years ago
Identify the independent and dependent variables Mindy and her lab group are given 2 aloe vera plants as test subjects and are a
yulyashka [42]

Answer:

Independent variable: Amount of sunlight

Dependent variable: Plant height

Explanation:

The independent variable is the one that a scientist intenionally changes in an experiment, while the dependent variable is the one that changes in response to the independent variable. In this case, the amount of sunlight given to each plant is intentionally varied so it is the independent variable, while the height of each plant depends on the amount of sunlight given so it is the dependent variable.

If you would further tutoring for FREE, check out www.growthinyouth.org.

3 0
3 years ago
Green plants are producers what does this mean
3241004551 [841]

Green plants are called producers because they make their own food out of water and carbon dioxide in the presence of sunlight. The organisms that are capable of preparing their own food from simple inorganic substances like carbon dioxide and water by using sunlight energy in the presence of chlorophyll are called producers. The green plants synthesise their own food through the process of photosynthesis and thus are called the producers.

7 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Illnesses that pass from one organism to another are called _____ diseases.
    15·1 answer
  • Identify three structures which provide support and protection in a eukaryotic cell.
    12·2 answers
  • Which element is present in all macromolecules in the human body?
    10·1 answer
  • Which of the following materials could have been found in the giant clouds that form the SolarSystem
    5·1 answer
  • Environmental impact of stem cells
    13·2 answers
  • Eight gain occurs when a person consumes too much/many __________.
    8·1 answer
  • How do I complete the following table regarding genotypes, phenotypes, and potential blood donors?
    13·1 answer
  • (a) What is the normal temperature of a<br>human body​
    5·2 answers
  • What is the sequence of amino acids formed from this gene?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!