1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erik [133]
3 years ago
15

Which of these is an example that scientific knowledge can always be reviewed? A) A water molecule was thought to be made of ato

ms of hydrogen and oxygen. B) Elements were thought to be pure substances made of atoms of the same kind. C) The fact that a year consists of 365 days was established long ago and is still accepted today. D) The idea that the sun moved around the earth was revised to state that the earth moved around the sun.
Biology
1 answer:
neonofarm [45]3 years ago
4 0
<span>D) The idea that the sun moved around the earth was revised to state that the earth moved around the sun.</span>
You might be interested in
Which of the following statements best describes chemical weathering
Maru [420]
Process by which rocks and minerals undergo a change in their compostion
6 0
3 years ago
Read 2 more answers
Which best describes how water moves during osmosis apex
Allushta [10]
Osmosis: In osmosis, water always moves from an area of higher water concentration to one of lower concentration. In the diagram shown, the solute cannot pass through the selectively permeable membrane, but the water can.
3 0
3 years ago
Which of the following statements most accurately describes how water
Rashid [163]

Answer:

D

Explanation:

gaseous water moves from the atmosphere to earths rivers and oceans

6 0
3 years ago
Please help i have no idea.
amid [387]
The answer is D, ADP gains a phosphate and that is used to convert to ATP with a product of ATP and water
5 0
3 years ago
Read 2 more answers
What is a description of cancer?
Natali [406]

Cancer: An abnormal growth of cells which tend to proliferate in an uncontrolled way and, in some cases, to metastasize (spread). Cancer is not one disease. It is a group of more than 100 different and distinctive diseases. Cancer can involve any tissue of the body and have many different forms in each body area.


im pretty  sure   it is the first one


7 0
3 years ago
Read 2 more answers
Other questions:
  • In bacterial cells, Choose one:
    15·1 answer
  • Explain why sexual reproduction increases variation among offspring much more than asexual reproduction does.
    7·1 answer
  • What is the difference between a gene and a allele?
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • To test the hypothesis that plants grow faster in green light, a student set up 3 of the same type of plants. She placed the fir
    15·1 answer
  • ​Which of the following statements is true regarding Cells A and B?
    13·1 answer
  • Can similar mineral composition be found in rocks both the Rocky Mountains and the Great Plains even though the rocks look so di
    13·1 answer
  • Can somebody help me on this
    7·1 answer
  • Links newly placed DNA fragments together &amp; Connects the new half of the DNA strand to the
    11·1 answer
  • True or false: concept that cells or organisms maintain specific internal conditions
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!