1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MaRussiya [10]
3 years ago
9

The cells in the nervous system that fill spaces and give support to neurons are called

Biology
1 answer:
Dafna1 [17]3 years ago
7 0
Neuroglial Cells is the answer
You might be interested in
If a DNA molecule is compared to a spiral staircase what parts makes up the steps
Burka [1]
<span>pairs of nitrogen bases.  I hope It will halp
</span>
8 0
3 years ago
Read 2 more answers
Scientists combine evidence from fossils, body structures, early development, DNA, and protein structures to:___________a. deter
umka2103 [35]

Answer:

b. determine the evolutionary relationships among species

Explanation:

Biologists through the analysis of characters obtained from molecular, morphological, embryological, physiological and behavioral analyzes look for the relationship between species and their origin.Through these coincidences phylogenetic trees are made.

5 0
3 years ago
A woman is 20 weeks pregnant. the nurse would expect to palpate the fundus at which location?
madam [21]

It is located At the umbilicus

At 20 weeks' gestation, the fundus can be palpated at the umbilicus. A fundus of 12 weeks' gestation is palpated at the symphysis pubis. At 16 weeks' gestation, the fundus is midway between the symphysis pubis and umbilicus. At 36 weeks' gestation, the fundus can be palpated just below the ensiform cartilage.

8 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Choose the answer.
IRINA_888 [86]

Answer:

B

Explanation:

When a Physician writes orders as ad lib, this means that the patient that the order is written for can have as much as they desire of the specific item that the Physician specifies in the order.

4 0
3 years ago
Other questions:
  • European rabbits were introduced into Australia and quickly spread, reproduced, and became a terrible pest. They eat up to $600
    14·1 answer
  • HELP ASAP!
    5·2 answers
  • A common inhabitant of human intestines is the bacterium Escherichia coli. A cell of this bacterium in a nutrient-broth medium d
    5·1 answer
  • A human somatic cell contains 46 chromosomes. How many chromosomes are found in a human egg cell?
    10·2 answers
  • Hyposecretion of what hormone could cause the symptoms of low basal metabolic rate, weight gain, fatigue, slowed heart rate, dep
    7·1 answer
  • What do genetics traits have to do with survival?
    8·1 answer
  • What are the organs that comprise the circulatory system?
    10·1 answer
  • Ribosomes are the site where __ is produced ?
    9·1 answer
  • ASAP please!!! Brainiest if correct!
    14·1 answer
  • Nutrients are molecules that can be found in______​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!