1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
4 years ago
10

In this cereal, how many calories do you get per serving from nutrients other than fat?

Health
1 answer:
anzhelika [568]4 years ago
6 0
I'm pretty sure we're missing something, was there an image that came with this? Like a nutritional label or something?
You might be interested in
2. Based on what you have learned in these studies, identify three guidelines for achieving optimal health. Then describe three
alexandr402 [8]

Mental health

1. Learn how to deal with stress: Like it or not, stress is a part of life. Practice good coping skills: Try One-Minute Stress Strategies, do Tai Chi, exercise, take a nature walk, play with your pet or try journal writing as a stress reducer.

2. Quite your mind: Try meditating, Mindfulness and/or prayer. Relaxation exercises and prayer can improve your state of mind and outlook on life.  

3. Take care of your body: Taking care of yourself physically can improve your mental health. Be sure to:

Eat nutritious meals, Avoid cigarettes, Drink plenty of water etc.

Physical health

1. Exercise regularly: Take a walk, ride a bike, or jog around the neighborhood. During inclement weather, head to the local mall or exercise at home.

2. Get a goodnight sleep: Sleep allows the body to restore itself, cells to repair themselves, and the brain to reboot. Seven or eight hours each night should do the trick.

3. Drink more water and fewer sugary drinks: Staying properly hydrated helps the body's cells to function more efficiently. Cutting back on sugary drinks is good for your dental health, your weight, and your budget.

Physical fitness

1. Balance: exercises can make it easier to walk on uneven surfaces and help prevent falls. To improve your balance, try tai chi or exercises like standing on one leg

2. Flexibility: exercises stretch your muscles and can help your body stay limber. Yoga and doing various stretches can make you more flexible.

3. Strength, or resistance training: exercises make your muscles stronger. Some examples are lifting weights and using a resistance band.

3 0
3 years ago
An individual health is predetermined and a person choice do not have any influence on their health
9966 [12]
The answer to this would be false

7 0
3 years ago
EASY: Should i submit an assignment i’m not sure about? yes or no? NO LINKS OR RANDOM ANSWERS OR YOULL BE REPORTED I JUST NEED H
Allushta [10]

Answer:

If you feel like it is right you should, and if you feel like something is wrong then try to check it again and see if you want to sumbit it.

8 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
a coach wants her team to have fun, win some games and be a productive unit. What is the most important personality trait the co
dlinn [17]

Answer:

the most important personality trait would be determination

Explanation:

8 0
4 years ago
Other questions:
  • Ethics is a critical component of the workplance in the healthcare industry. you are about to complete your 90-day probationary
    7·1 answer
  • Which of the following is evidence that a subthreshold EPSP has occurred?
    9·1 answer
  • Why is Takraw not commonly played in the USA?
    7·1 answer
  • (4.26) Some studies have suggested that a nightly glass of wine may not only take the edge off a day but also improve health. Is
    9·1 answer
  • What's the difference between blocked and partially blocked choking? How do you care for each?
    9·1 answer
  • The Ohio Surgery Center in Columbus, Ohio, is accredited by the Joint Commission. A benefit of the Joint Commission’s accreditat
    8·1 answer
  • What determines the amount of stress a person currently experiences?
    9·1 answer
  • Which system is not directly connected to itself?
    8·2 answers
  • Which actions are recommended if a person wants to keep a healthy weight?
    8·1 answer
  • Which is the healthiest strategy for coping with strong emotions?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!