Because havee a especial character who acn do thant
Answer:
Increasing the size of the cube-shaped cell increases the volume. However, the surface area-to-volume ratio decreases. This means that the simple diffusion would take more time distribute nutrients across the cell (and even in the eliminate waste). It would need bulk transport such as vesicle transport, otherwise cell activities would slow down.
Answer:b; exocytosis
Explanation: leukocytes are amoeboid white blood cells, which are involved in immune response .such response included combating foreign bodies like micro organisms which invade the body.they do this by engulfing the micro organisms and digesting them.
Phagocytosis, pinocytosis, receptor mediated endocytosis are the ways in which the cells engulfs the Invaders.
In endocytosis,the membrane of the cell traps the organism by forming an invagination.it then encloses the micro organism and digests it.
<u>Answer:</u>
Discovery of vaccine for smallpox, viruses and actual organisms that cause many diseases lead to the development of Germ Theory.
<u>Explanation:</u>
- Theory was the 'predominant theory' of 'disease transmission' before germ theory but it is no longer accepted as a 'scientific theory' of diseases.
- 'Formal and reliable experiments' on germs and diseases relationship were 'conducted by Louis Pasteur'.
- He showed that growth of microorganisms was not a spontaneous generation and his pasteurization experiment provided key pieces of evidence that supported germ theory.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
