Which is RNA polymerase binding site on a typical gene?

2 answers:

7 0

The correct answer is A, the "promoter" site is the RNA polymerase binding site on a typical gene. This is how the process of gene expression begins. The RNA polymerase (a protein that builds RNA) binds to the promoter site of the DNA strand. It then begins the process of 'transcribing' the DNA code into an RNA strand, which can then be 'translated' into an amino acid chain to form a protein, which is the expression of the gene.

Law Incorporation [45]3 years ago

7 0

"promoter" refers to the RNA polymerase binding site

You might be interested in

Capsular hydrostatic pressure is the chief force pushing water and solutes out of the blood and across the filtration membrane.

frozen [14]

Answer:

False

Explanation:

Capsular hydrostatic pressure is not the main force that pushes water and solutes out of the blood and through the filtration membrane. On the contrary, this pressure acts against the filtration membrane, making it difficult for water and solutes to escape from the blood.

Increasing this pressure decreases the infiltration rate and causes obstruction of the urinary tract that tends to accumulate urine, causing a lot of pain to the patient with Renal Failure.

3 0

3 years ago

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

3 years ago

California enacts a statute to ban advertising in "bad taste." This stat-ute would likely be held by a court to be

emmainna [20.7K]

Answer:

Option A, an unconstitutional restriction of speech

Explanation:

Please see the attachment