1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
3 years ago
11

Helpp !

Biology
1 answer:
KIM [24]3 years ago
8 0

Answer:

B. sending neurotransmitters to endocrine target cells

Explanation:

Your endocrine system works closely with your brain and central nervous system to control the creation of specific hormones and enzymes.

You might be interested in
What innate immune component is directly responsible for the lysis of the cell membrane of invading microorganisms?
larisa86 [58]

Answer:

The name of the innate immune component is MEMBRANE ATTACK COMPLEX.

Explanation:

The membrane attack complex is a type of structure that is usually formed on the surface of the cell membrane of invading pathogens due to the activation of the immune system. Membrane attack complex is also known as terminal complement complex. Individuals that lack this immune component due to mutations usually experience recurrent infections.

4 0
3 years ago
Pathways that support communication among the various electronic components on the system board are called _______.
astraxan [27]

Answer: bus lines

Explanation:

7 0
2 years ago
What prediction can you make about future levels of carbon dioxide (co2) in the atmosphere??
Allisa [31]
Well to me if the rate of industralization continues deforestation will increase which will lead to accumulation of CO2 in the atmosphere. Also if combustion of fossil fuels will also lead to high rates of C02 so unless measures are taken the rate of C02 in the atmosphere will greatly increase in the nearest future
4 0
3 years ago
Read 2 more answers
3.
Andreas93 [3]

Answer:

They have genetic material.

Explanation:

All three domains and viruses have genetic material. They have to, otherwise they couldn't reproduce, whether sexual or asexual. In viruses, it can be RNA or DNA; obviously in eukarya it tends to be DNA, remembering that humans are eukaryotes; and in the other two domains a similar pattern is followed.

Why not the other options?

They are composed of cells

  • Viruses technically don't have "cells," and even to say cells plural can be a misnomer for some of the more simple forms of life that are unicellular.

They are living things.

  • All three domains are alive (bacteria, archaea, eukarya) but viruses are technically not considered to be alive.

They have organelles.

  • Eukarya and prokarya technically both have organelles (think of prokaryotic ribosomes), but not all groups that you mentioned have organelles. Remember that organelles ("little organs") are specific groups of cells performing a function, and they usually have names.
4 0
3 years ago
Which is the best hypothesis for the scientific question "How does light intensity affect the rate of photosynthesis ?"
Dima020 [189]

If the distance between the source of light and the plant is increased, the rate of photosynthesis will decrease.

5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The apical ends of intestinal cells face the intestinal channel and have long processes that facilitate the absorption of nutrie
    13·1 answer
  • A group of cells that have the same function is called a(n) _________
    10·2 answers
  • Which lobe is important for hearing? temporal occipital parietal frontal
    10·1 answer
  • Glycerophospholipids have ________ heads and long ________ fatty acid tails.
    11·1 answer
  • 9. Describe step 1 of cellular respiration.
    12·1 answer
  • Name some harmful substances found in cigarette smoke. How do these
    14·1 answer
  • Why do scientists make a hypothesis before an experiment
    8·1 answer
  • Phương pháp cố định mẫu
    5·1 answer
  • I'm like the UPS guy, I deliver stuff. Proteins and nutrients throughout the cell, I've gotten really buff. I gather molecules a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!