1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
8

Which of the followingcharacteristics determines when the refractory period ends?

Biology
1 answer:
kondor19780726 [428]3 years ago
3 0

Explanation:

<u>-how long it takes for the voltage-gatedNa+ channels to close at the end of an action potential</u>

Neurons have unique structures which aid in facilitating communication by sending and receiving electrical signals very efficient.

The refractory period describes a period between the initiation of an action potential where Na+ channels are closed, and immediately after the action potential’s peak. Action potentials would require an influx of more positively charged ions; these must be more than a specific threshold in order to have the cells send along more action potentials which helps with figuring out stimulus intensity.

Potassium ions readily diffuse out of the cell more quickly than sodium due to the presence of more channels which allow for potassium leakage. The sodium pumps in neuronal membranes bring more Na+ than K+ ions into the cell; with every three sodium ions pumped out two potassium ions are brought in- this is in order to maintain the negatively charged membranes within the cell along with the resting potential.

Learn more about the autonomic nervous system at brainly.com/question/10386413

Learn more about neurotransmitters at brainly.com/question/9424160

Learn more about homeostasis at brainly.com/question/1601808

#LearnWithBrainly

You might be interested in
Distingush between prokaryotic cell and eukaryotic cell by selecting the accurate statements that apply to eukaryotic cells
Igoryamba

The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not. ... Prokaryotes, on the other hand, have no membrane-bound organelles. Another important difference is the DNA structure.

8 0
2 years ago
I NEED HELP PLEASE ASAP/Abigail's toaster produces 50 units of heat and 5 units of light for every 100 units of electricity it u
Svet_ta [14]
The answer would be 55 percent
8 0
3 years ago
Why is it hard to cure a common cold
Igoryamba

because a cold is a virus and not a bacteria.

5 0
3 years ago
Study the information within the table below and then answer the following question.
adelina 88 [10]

Answer:

1:1

Explanation:

Purines: adenine (A), guanine (G)

Pyrimidines: thymine (T), cytosine (C)

Totals:

\left[\begin{array}{cccc}A&T&G&C\\82.4&80.8&69.1&68.4\\\end{array}\right]

\left[\begin{array}{cc}Purines&Pyrimidines\\151.5&149.2\\≈150&≈150\\ \end{array}\right]

8 0
3 years ago
The process that enables cells of the body to burn food and release energy is called
serg [7]

...respiration!

Respiration is the biochemical process in which the cells of an organism obtain energy by combining oxygen and glucose, resulting in the release of carbon dioxide, water, and ATP (the currency of energy in cells). Source: https://study.com/academy/lesson/what-is-respiration-definition-process-equation.html

I hope that helps! :)

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Students in a science class were asked to investigate how missing or damaged
    8·1 answer
  • All of the factors below play a role in creating ocean currents. Which factor has the greatest influence on weather patterns?
    11·1 answer
  • Why did life first occur in the oceans and not on Earth’s surface?
    10·2 answers
  • Black is dominant over white in the coat color of guinea pigs. Assume that a cross is made between a hybrid male black guinea pi
    7·1 answer
  • How are prokaryotes and eukaryotes different?
    7·2 answers
  • What are ribs? Use in your own words.
    14·1 answer
  • How does the fossil record support the evolutionary theory?
    13·1 answer
  • How long does it take for ancestry dna results to come back
    13·1 answer
  • Differences between bacteria and plants
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!