1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
9

HELP PLEASE!!!! Solve for x. Round your answer to the nearest tenth.

Mathematics
1 answer:
Nataly_w [17]3 years ago
6 0
Perpendicular from the center to the chord, bisects it!
DE = DF/2 = 12
To find R, use Pyth Th in triangle AOB. ( AB = 10)
10^2 + 14^2 = R^2
100+ 196 = 296 = R^2
In triangle DOE 
x^2 + 12^2 = 296
x^2 = 296-144 = 152
x = √152
x = 12.3



You might be interested in
a side of the triangle below has been a extended to form an exterior angle of 159°. find the value of x
Mashcka [7]

Answer:

Step-by-step explanation:

Find the the angle by subtracting 159 from 180 that’s your answer= 21 degrees

6 0
3 years ago
You are competing in a foot race. You are at point B (8,5) and the finish line is at point A (-5,5) how far are you?
ra1l [238]

Answer:

13

Step-by-step explanation:

-5+x=8

isolate the x by moving the adding -5 to both sides

x=13

3 0
3 years ago
Throughout history, people have kept track of time by making
horrorfan [7]

Answer:

secondary sources cause that what makes them

7 0
4 years ago
7-2(2+3x)=27what is he answer
Taya2010 [7]
<span>Simplifying 7 + -2(2 + 3x) = 27 7 + (2 * -2 + 3x * -2) = 27 7 + (-4 + -6x) = 27 Combine like terms: 7 + -4 = 3 3 + -6x = 27 Solving 3 + -6x = 27 Solving for variable 'x'. Move all terms containing x to the left, all other terms to the right. Add '-3' to each side of the equation. 3 + -3 + -6x = 27 + -3 Combine like terms: 3 + -3 = 0 0 + -6x = 27 + -3 -6x = 27 + -3 Combine like terms: 27 + -3 = 24 -6x = 24 Divide each side by '-6'. x = -4 Simplifying x = -4</span>
8 0
3 years ago
Read 2 more answers
How many 3 did git numbers can be formed by rearranging the digits in the set {2,3,4} if the number must be odd?
Liono4ka [1.6K]

2!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

7 0
3 years ago
Other questions:
  • How do you solve |x-5|<img src="https://tex.z-dn.net/?f=%5Cgeq" id="TexFormula1" title="\geq" alt="\geq" align="absmiddle" class
    9·1 answer
  • The capacity of a school is 1100 students and the current enrollment is 980 students. If the student population increases at a r
    6·2 answers
  • What vocabulary term describes symbols that represent numbers whose quantity we don't know?
    14·1 answer
  • The distance S that a certain object falls from a height of 350 ft in T seconds is given by the following formula.
    5·1 answer
  • 50 yards of tape is needed to pack and ship 100 packages. You have roll of tape that is 2000 inches long. About how many yards d
    15·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How do i solve for x (2x-8)=0
    8·1 answer
  • What is the surface area of a cylinder with base radius 222 and height 999?
    8·1 answer
  • Emilio drew a line that is modeled by the equation y-4=3(x-2) what is the slope of the line?
    11·1 answer
  • Can someone please help me <br><br> Solve for y. Show your work<br> 1. y - 3x &lt; 5
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!