1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scZoUnD [109]
3 years ago
6

there is a higher sodium concentration on the inside of the cell than there's an outside of the cell how would have sodium parti

cles move and by what process
Biology
1 answer:
NemiM [27]3 years ago
8 0
The sodium could move through the cell's membrane by diffusion.

Diffusion<span> is the net movement of molecules or atoms from a region of high concentration (or high chemical potential) to a region of low concentration (or low chemical potential) as a result of random motion of the molecules or atoms.</span>
You might be interested in
"__________ pressure, the difference between the intrapulmonary and intrapleural pressures, prevents the lungs from collapsing."
Mamont248 [21]
Transpulmonary pressure, the difference between intrapulmonary and intrapleural pressures, prevents the lungs from collapsing 
8 0
3 years ago
3. Which one of the following statements best describes the first thing researchers need to do to manipulate
dmitriy555 [2]
<span>A. Restriction enzymes would be used to cut the DNA into smaller pieces. The first step in DNA manipulation for genetic engineering is </span>to choose the piece of DNA from a source. Restriction enzymes are used in cutting these DNA pieces.
3 0
3 years ago
Read 2 more answers
Microscopic mites lie at the base of human eyelashes, where they feed on tiny bits of dead skin.what type of symbiosis could thi
Rama09 [41]
<span>This type of symbiosis is commensalism. Commensalism is a relationship between two organisms in which one benefits from the other and the other organism is not affected in any way. From the question above, in the relationship, microscopic mites are the commensals as they benefit from their host; humans and humans neither benefit nor are harmed.</span>




5 0
4 years ago
When the patch occupancy rate (c) equals the patch extinction rate (e), patch occupancy (P) is
IgorC [24]

Answer:

When the patch occupancy rate (c) equals the patch extinction rate (e), patch occupancy (P) is 0

Explanation:

According to Levin's model (1969):

<em>dP/dt = c - e</em>

where P represents the proportion of occupied patches.

<em>c</em><em> </em>and <em>e </em>are the local immigration and extinction probabilities per patch.

Thus, the rate of change of P, written as dP/dt, tells you whether P will increase, decrease or stay the same:

  • if dP/dt >0, then P is increasing with time
  • if dP/dt <0, then P is decreasing with time
  • if dP/dt = 0, then P is remaining the same with time.

The rate dP/dt is calculated by the difference between colonization or occupancy rate (<em>c</em>) and extinction rate (<em>e</em>).

c is then calculated as the number of successful colonizations of unoccupied patches as a proportion of all available patches, while e is the proportion of patches becoming empty. Notice that P can range between 0  and  1.

As a result, if the patch occupancy rate (c) equals the patch extinction rate (e), then patch occupancy P equals to 0.

7 0
4 years ago
If the volume of a mineral is 6 and the mass is 3, what is its density?
Marina86 [1]

Answer:

0.5

Explanation:

Density=mass÷volume

So the density of the mineral is 3÷6 which equals 0.5

3 0
4 years ago
Other questions:
  • Children are vaccinated against tetanus. Explain why these children do not get tetanus if the bacteria enter their body through
    12·1 answer
  • You don't have to answer all of them but please answer some....thanks
    9·1 answer
  • When did soft-bodied, multi-celled animals first appear?
    9·1 answer
  • Plants don't move arou d so why don't move around,so why do they need energy
    7·2 answers
  • What is a shared characteristic of all animals
    6·2 answers
  • Chemicals used in chemotherapy treatments to fight cancer can also harm cells in hair follicles and bone marrow. What characteri
    10·1 answer
  • What happens during interphase
    6·2 answers
  • Describe the unique intercellular connections between muscle cell
    13·2 answers
  • What type of cell is autotrophs and heterotrophs
    5·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!