Yes that’s circlet make me brainiest
Frequency is the term that describes the number of waves passing a point during a certain period of time, frequency is also measured in Hz (hertz).
Biotic factors are anything in a ecosystem that is living, was living, or is going to live.
From this we can conclude that the biotic factors are remains of dead organisms and flora and fauna.
Temperature and minerals in the soil are abiotic, meaning they will never live.
A sudden shift in the tectonic plates of the earth
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
