1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
4 years ago
15

If a circle is divided into 12 equal arcs, then each arc measures 30 degrees.

Biology
2 answers:
lions [1.4K]4 years ago
3 0

this statement is true bc there is 360 degrees total and if you divide that by 12 you would get 30
Amiraneli [1.4K]4 years ago
3 0

This statement is true.

If a circle is divided into 12 equal arcs then each arc measure 30 degree.

The sum of all the angles in a circle is 360 degrees. If the circle is divided into 12 arcs then it means 360/12= 30 degree.

This means that when a circle is divided into 12 arc each arc will be of 30 degree.

You might be interested in
.................................
d1i1m1o1n [39]
Yes that’s circlet make me brainiest
7 0
2 years ago
Read 2 more answers
Which term describes the number of waves passing a point during a<br> certain period of time?
serg [7]

Frequency is the term that describes the number of waves passing a point during a certain period of time, frequency is also measured in Hz (hertz).

7 0
3 years ago
Biotic factors in the environment include ???
Anon25 [30]
Biotic factors are anything in a ecosystem that is living, was living, or is going to live.

From this we can conclude that the biotic factors are remains of dead organisms and flora and fauna.
Temperature and minerals in the soil are abiotic, meaning they will never live.
6 0
3 years ago
Read 2 more answers
Tsunamis, like the one that hit northeastern Japan in March 2011, are usually caused by
ololo11 [35]
A sudden shift in the tectonic plates of the earth
3 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
4 years ago
Other questions:
  • Which type of biomacromolecule contains paired bases? A. Protein B. Carbohydrate C. Lipid D. Nucleic Acid
    6·2 answers
  • In order to classify a mineral, scientists will sometimes scratch the mineral with a piece of unglazed porcelain and then analyz
    15·2 answers
  • Absorption is the process by which nutrients move into the bloodstream <br>true or false
    11·1 answer
  • What is one distinguishing feature between domain bacteria and domain Archea
    15·1 answer
  • How are the energy needs of plant cells similar to those of animal cells? How are they different?
    7·1 answer
  • The time required for one complete cycle of binary fission is known as
    11·1 answer
  • Which of these are electromagnetic waves?
    11·1 answer
  • What are the two bands of latitude on Earth that receive no light at times called?
    12·2 answers
  • Researchers performed an experiment to investigate DNA replication. First, they synthesized radioactively-labeled nucleotides, w
    5·2 answers
  • Nervous:_________;; respiratory
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!