1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elan Coil [88]
2 years ago
15

A grandmother, two mothers, and two daughters went to a baseball game together and bought one ticket each. NOTHING DONT ANWER i

want a bf, im blonde and very pretty. you must be super hot. send applications below <3
Biology
1 answer:
zepelin [54]2 years ago
5 0

Answer:

LOL OK

Explanation: hope u get one

You might be interested in
Systolic and diastolic blood pressures are affected differently by exercise? what could account for the difference?
kondaur [170]
Your heart has to work hard to pump more blood during exercise for each contraction, accounting for the increase in the systolic blood pressure. Diastolic pressure tends to not change at all or change slightly. The reason for this is that since the blood flow is increased during exercise, our arteries dilate, making the diastolic pressure stay the <span>same, or decrease slightly.</span>
5 0
3 years ago
A nurse is promoting routine papanicolaou tests to young adult women at a community based preventative care health fair. a pap t
ryzh [129]
A pap test is a screening test that can detect pre-cancerous and cancerous cells and processes in an important part of the female reproductive system, the cervix. It is at the secondary level of preventative care, because it screens asymptomatic individuals to detect as soon as possible a serious disease.
8 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Endosymbiotic theory is supported by similarities between chloroplasts and * Cyanobacteria Viruses Yeasts None of the above
stiv31 [10]

Answer:

Endosymbiotic theory is supported by similarities between chloroplasts and * Cyanobacteria.

Explanation:

The endosymbiotic theory proposes that mitochondria and chloroplasts were once free-living bacteria that were phagocytized by another cell but not digested. These bacteria got to adapt to their host, and both cells became interdependent.  

Both organelles have many similarities with other free-living bacteria. Chloroplasts probably derivate from cyanobacteria because both cells absorb sunlight, produce ATP, and organic molecules. And mitochondria derivate from rickettsias because they produce ATP in the same way by using the Krebs Cycle and Oxidative Phosphorylation.

From the phagocytosis moment, these two cells became so dependant on each other, they could not survive without the other one.  

Chloroplasts and mitochondria share some traits with free-living bacteria, that support the theory.  

• Both organelles present their genetic material. This DNI is independent of the cells´ DNA, is bi-catenary and circular, identical to the bacterial DNA, and very different from the one of the eukaryotic cells.

• Both organelles divide by binary fission, not by mitosis, and can synthesize their ribosomes and organelles.    

• Both organelles present a double membrane, a characteristic that reinforces the idea of being phagocyted. The internal membrane looks identical to the bacterial membrane, while the external membrane looks like the eukaryotic one.  

In fact, in this internal membrane are placed the energy centers, just as it occurs in bacterias membrane.  

• Finally, the sizes of the organelles are similar to the size of some procaryotes

6 0
2 years ago
This procedure for measuring cell size has certain limitations . List three such limitations​
marusya05 [52]

The limitations of cell size are:

1) Surface area to volume ratio

2) Nucleo cytoplasmic ratio

3) Fragility of cell membrane

What are the cause of limitations on cell size?

The need for a surface area of sufficient area to allow the cells function→.

→If the surface area of cell increase volume increase to the cube of the linear increase.

→ Nuclie contains information needed for protein synthesis . Some cells reduce this limitation to increase the no. Of nucleus called multinucleated.

Examples are muscle cells.

to learn more about Cells click brainly.com/question/7202108

#SPJ9

3 0
1 year ago
Read 2 more answers
Other questions:
  • Choose which way of evolution caused the FQ antibiotic resistance.
    13·1 answer
  • Explain the antigen-antibody response as it relates to blood groups
    6·1 answer
  • When listening the levels of organization in organisms from smallest to most complex which level is just below organs complexity
    13·1 answer
  • Question 1 (3 points)
    10·1 answer
  • To which skeletal system do the carpals belong to?
    15·2 answers
  • What organism uses carbon dioxide and for what purpose is it used?
    14·2 answers
  • Which are functions of endoplasmic reticulum
    10·1 answer
  • Help asap pls.❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗❗
    15·2 answers
  • rections: bw that you have Identified the different animals that can be raised as an alternative source of come for the family,
    13·1 answer
  • Define “science” in 20 words
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!