A Beaker is a laboratory tool used to measure exact measurements of water
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
vast deferens tested seminal vesicles prostate gland
The process which occurs in the structures that are labeled X is Kreb's cycle.
It has to do with releasing stored energy in the form of adenosine triphosphate (ATP). This is an extremely important part of metabolism and was first introduced by Hans Adolf Krebs in 1937.
Well all you have to do is read the part you are supposed to put in your own words in, then write it down on paper, then you could paraphrase it here so you wont get plagirized for it:http://paraphrasing-tool.com/
All you have to do is then put the info you just wrote, and then type it in the first box, then click ( im not a robot) so then GO! an then in the box below the GO! button just write that down own your paper.
For part two you just write down three things on what YOU LEARNED from <span>Abraham Lincoln and the civil war from reading the book
For part 3 it is based on your opinion.
I hope this helps this took me a long time to type!
Have a good evening</span>