1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
11

Once isolated, the identical population of shrimp began to evolve differently from one another. What factors may have caused the

se separated groups to physically change from their original parent species?
Biology
1 answer:
omeli [17]3 years ago
4 0
In the enviroment isolated , animals have the time to "adapt" t their surroundings.
You might be interested in
List the 8 characteristics
lianna [129]

Answer:

8 chareristic of what? of life?  cellular organization, reproduction, metabolism, homeostasis, heredity, response to stimuli, growth and development, and adaptation through evolution.

3 0
3 years ago
Read 2 more answers
This is for biology, I’ve been having some trouble on it please help!
nata0808 [166]

Answer:

um you have to be more clear plssssss

8 0
2 years ago
Read 2 more answers
How does Earth Science and Environmental Science relate
Alecsey [184]
They both envole the earth
8 0
3 years ago
Some students take care a vegetable garden. When it is time to plant in the spring, the students leave part of the garden empty
muminat

Answer:

i honestly think B might be the answer, most plants and vegetables get grown weeds and other plants grown around them, if not that C is the answer

Explanation:

5 0
3 years ago
Read 2 more answers
Other Forms of Energy
Degger [83]

Answer:

D. thermal energy

that is the answer

8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the definition of a stem and leaf plot in math?
    15·1 answer
  • If you take energy away from gas, what most likely will happen to a substance?
    11·2 answers
  • 1.
    12·1 answer
  • Please answer! Earth science.
    9·1 answer
  • You can be infected with a virus and not even know it.<br> a. True<br> b. False
    11·2 answers
  • Many scientists are concerned that the Oglala Lakota aquifer in the United States is being depleted at an alarming rate. What wo
    9·1 answer
  • Part A: If one follows 70 primary oocytes in an animal through their various stages of oogenesis, how many secondary oocytes wou
    12·1 answer
  • Which one is a chemotroph?
    5·2 answers
  • What is the temperature of the water at a cold seep?
    13·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!