1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
3 years ago
6

Pesticides are used on crops to prevent the crops from being eaten by pests such as insects. The chemicals in the pesticides kil

l the insects. Which of the following is a negative effect that could result from the increasing use of pesticides? AThe chemicals in the pesticides could run off into water sources and contaminate them, which would kill many aquatic species. B.The chemicals in the pesticides could help the plants grow bigger and taller because they are no longer being eaten by pests. C. The chemicals in the pesticides could cause the pests to start eating livestock instead, decreasing the amount of food available to humans. D. The chemicals in the pesticides could kill many insects, resulting in humans having a greater source of food.
Biology
1 answer:
Gnom [1K]3 years ago
4 0
The answer is option a.
You might be interested in
If the central nervous system is the main control center for the body, the peripheral nervous system is the ____________.
KiRa [710]
The answer is A the central nervous system sends a message to the brain and then peripheral nervous system sends out the message to react. I think hope I helped
5 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
One strategy to help cover college tuition costs might be to attend a:
nikklg [1K]
Are there any answer choices ?
3 0
3 years ago
Heredity Lab Report
Elena L [17]
Do you still need the answer?
8 0
2 years ago
Which of the following solutions will best enable Josey to see the onion cells detail?
just olya [345]
I have 2 answers a and d but i think its d i am not sure if it’s correct
7 0
3 years ago
Other questions:
  • Alison wants to construct the perpendicular bisector of mn¯¯¯¯¯¯¯. what should alison do for her first step?
    9·2 answers
  • The cordilleran orogenies, from oldest to youngest, are ________ .
    10·1 answer
  • A 77-year-old client is brought to the emergency department by her son. the client has a severe headache and lack of sleep becau
    13·1 answer
  • What is the synonym for genetic engineering?
    14·1 answer
  • In the mouse, gene A allows pigmentation to be deposited in the individual coat hairs; its allele a prevents such deposition of
    12·1 answer
  • Evolution at its base is about change. Change over time spans that humans can't even wrap their heads around. Just like a river
    8·1 answer
  • The _____ is critical in the cell cycle because it indicates the cell is ready for division.
    15·2 answers
  • According to the general equation for conditional probability, if p (a^b')=1/6 and p(b')=7/12 , what is the value of p(a[b)?
    7·1 answer
  • Need help Plz!!!!
    5·1 answer
  • _____________ are present in an organism, but they don't function in the same way they used to. HELP ILL GIVE BRAINLIEST!!! pict
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!