1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
5

how do I find the mothers genotype if I know the genotype of the fater and only the two sons instead of three

Biology
1 answer:
telo118 [61]3 years ago
7 0

Answer:

A blood test is used to determine whether the A and/or B characteristics are present in a blood sample. It is not possible to determine the exact genotype from a blood test result of either type A or type B. If someone has blood type A, they must have at least one copy of the A allele, but they could have two copies

Explanation:

You might be interested in
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
Svetllana [295]

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

8 0
3 years ago
Where would you most likely find water molecules​
andriy [413]

Answer:

you would most likely find it in a oxygen atom.

7 0
3 years ago
PLZ I NEED HELP I WILL GIVE BRAINLIEST 1.Which material(s) or shapes and colors were used to represent the phosphate-sugar backb
aliina [53]

Answer:1. Phosphate= pink 2. blue

Explanation:

8 0
3 years ago
Wise and judicious use of plants and animals is called __________.
sattari [20]

Answer:

recycling

Explanation:

6 0
3 years ago
Read 2 more answers
Use the drop-down menus to identify the types of convergent boundaries labeled A, B, And C.
algol [13]
Oceanic-continental convergence occurs when an oceanic plate and a continental plate converge. They are pushed together and the oceanic plate is forced to go under the continental plate. So based on the diagram, this convergence occurred in letter B. 

Oceanic-oceanic convergence occurs when two oceanic plates collide into one another. The oceanic plate that is older, denser and/or colder will be the plate that will go under the other. It will be forced down into the mantle. So in our diagram, this occurs in letter A.

Continental-continental convergence occurs when two continental plates converge. In this case, the plates push up against each other and create mountain ranges. Unlike the other two, they do not sink down, the movement is upwards. This occurs in the area C of your diagram. 

6 0
3 years ago
Read 2 more answers
Other questions:
  • What determines fitness
    12·1 answer
  • How fast do seismec waves caused by earthquakes travel​
    7·1 answer
  • How can sediments negatively affect an aquatic system?
    7·1 answer
  • The farther a planet is located from the sun, the longer its day and year. How accurate is this statement?
    14·1 answer
  • What two levels of organization are used to name an organism in the eukarya domain?
    11·1 answer
  • ose the item in column 2 that best matches each item in column 1. axonemal microtubules nucleation treadmilling desmin EB1 Arp2/
    15·1 answer
  • Which sentence best describes active transport?
    8·2 answers
  • During which lunar phase is the moon’s far side entirely lit?
    11·1 answer
  • What is full course meal?​
    10·1 answer
  • Explain two ways in which the existence of green algae and land plants affected the early atmosphere.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!