1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
3 years ago
6

All cells go undergo mitosis at least every 12 weeks. TRUE OR FALSE?​

Biology
1 answer:
slega [8]3 years ago
5 0
<h2>I BELIEVE YOUR ANSWER IS FALSE </h2>
You might be interested in
Explain how similarities in the genetic codes of organisms are due to common ancestry and the process of inheritance.
Gwar [14]
Because since their ancestors came before them then they inherit certain beneficial traits that help them survive. Those traits are in the DNA and the animals are evolving to be more fit for the environment that they are in. (hope this helps)
8 0
3 years ago
Which kind of front brings rainy or snowy weather that lasts a very long time?
torisob [31]
Warm fronts
Not cold fronts because those move to warm
3 0
3 years ago
Read 2 more answers
The European Starling is an invasive species of songbird found here in the United States. The growing population of starlings ha
LuckyWell [14K]

Answer:

Explanation:

European starlings are agricultural pests. They damage crops and berries. European starlings also aggressively compete with native birds for the insects they eat. ... Large numbers of European starlings can cause dangerous and expensive damage to jet engines when they get sucked in.

6 0
3 years ago
"a man with genotype bb and a woman wth genotype BB have four children. how many of the children are likely to have blue eyes"
Sonja [21]

Answer:

No children will have blue eyes all of them carry brown eyes only.

Explanation:

The cross between a male with bb genotype and female with BB genotype will be as follows :

The gametes will be formed

male: b and b

female: B and B

By Punnett square:

        B          B

b       Bb        Bb

b       Bb        Bb

As all the offspring will have a heterozygous condition with dominant B (Brown) and recessive b( blue) so there are no offspring will be with the phenotype of the blue eyes.

4 0
3 years ago
For a given enzyme reaction, Km was determined to be 2.0 mM. In the presence of a competitive inhibitor (0.45 mM), the Km increa
alex41 [277]

Answer:

okro e

Explanation:

nejeoro

8 0
3 years ago
Other questions:
  • The thin external covering is similar to the _______. The organelle with a texture like sandpaper is the _______.1.
    11·1 answer
  • Which statements correctly describe theories? Check all that apply.
    14·2 answers
  • The mitochondrion is the place in the cell where
    9·1 answer
  • Is DNA found in all living or once living cells
    11·1 answer
  • Bonnie is preparing dinner and begins to wonder why cutting onions always makes her cry. Using the scientific method, she decide
    14·1 answer
  • What are the seven classification levels in Linnaeus’ system?
    15·1 answer
  • Consider the shape and structure of the virus in the diagram.<br> A helical virus is shown.
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Nutrition experts recommend that most people eat less than 2,300 milligrams of sodium a day for good heart health. What percenta
    15·2 answers
  • Supplemental appendix is to a book as a ____________ is to a bacterial chromosome. genetically modified organism plasmid restric
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!