AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Well, DNA contains the hereditary information in the form of sequences of nucleotides which categorize as genes, that provide the information for synthesis of structural, functional and various other proteins that in combination and or in other ways determine an organism's complex traits. The phenotype of the said organism.
The existence of being able to process photosynthesis.
Photosynthesis is a functional and adaptive mechanism which enables plants to make and create their own food with the use of sunlight. Also, water and carbon dioxide, oxygen is then the by product of this process which is beneficial to other organisms especially heterotrophs.
Answer:
Stomata
Explanation:
Photosynthesis is a unique phenomenon which occurs in the Chloroplast of plant cells. It is the way they synthesize their food in form of glucose. However, like every metabolic reaction, photosynthesis requires certain reactants and products.
Photosynthesis combines carbondioxide (CO2) gas and water (H2O) in the presence of sunlight to produce Glucose (C6H12O6) and oxygen gas (O2). The gaseous components of this metabolic activity enters (C02) and leaves (O2) the plant via a structure in the leaves called STOMATA.
STOMATA is a pore found in the epidermis layer of plant leaves that aids in the exchange of gases i.e. carbondioxide in, oxygen out during Photosynthesis.