Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
It’s important to know the possible genotypic and phenotypic ratios of different genetic crosses because the the phenotype shows what the offspring will physically look like what the genotype is what genes the offspring carries. phenotype doesn’t always show what alleles the offspring carries because if the offspring is heterozygous for the gene only the dominant allele shows and the recessive allele won’t be visible. the genotype can see what alleles the offspring carries, both dominant and recessive. knowing the genotype helps to know what alleles are passed on. if one of the parents have a genetic mutation that is passed on, the phenotype helps see what ration of offsprings will have the mutation visible and the genotype will help see what ratio of offsprings will pass on the allele for the mutation
probably isn’t useful. my brain is currently burnt
Answer:
I believe the answer is A: Neveah's mass would stay the same but her weight would decrease
Explanation:
I believe its A because the moon has about 1/6 as much gravity as the Earth. So if anything, her weight would decrease, not increase like B., C., or D says. I hope this is helpful to anyone who reads it!!! ;)
Because it carries a lot of blood to the arteries